1. Search Result
Search Result
Results for "

Murine

" in MedChemExpress (MCE) Product Catalog:

420

Inhibitors & Agonists

10

Biochemical Assay Reagents

38

Peptides

35

Inhibitory Antibodies

63

Natural
Products

11

Recombinant Proteins

19

Isotope-Labeled Compounds

17

Antibodies

2

Click Chemistry

5

Oligonucleotides

Targets Recommended:
Cat. No. Product Name Target Research Areas Chemical Structure
  • HY-114164G

    Thrombin Cardiovascular Disease
    Murine Thrombin is a Na +-activated, allosteric serine protease that plays opposing functional roles in blood coagulation. Thrombin recognition sequence and can be used to digest GST-tagged proteins .
    Murine Thrombin
  • HY-P2728A

    Biochemical Assay Reagents Cardiovascular Disease
    Murine Antithrombin III is a blood coagulation inhibitory enzyme with high catalytic efficiency, high specificity, mild action conditions, etc., and can be used in the pharmaceutical industry, industrial production, food manufacturing, aquaculture and other industries .
    Murine Antithrombin III
  • HY-132582A

    Tau Protein Cancer
    Tau ASO-12 (murine) (sodium) is a Tau-lowering antisense oligonucleotide (ASO) for murine use, and it has the potential for the research of Alzheimer Disease. (Tau ASO-12 sequence – 5′ GCTTTTACTGACCATGCGAG 3′ )
    Tau ASO-12 (murine) (sodium)
  • HY-125864B

    Biochemical Assay Reagents Cardiovascular Disease
    Murine Fibrinogen is a native fibrinogen from murine plasma .
    Murine Fibrinogen
  • HY-P2821B

    Biochemical Assay Reagents Cardiovascular Disease
    Murine Plasminogen is purified from freshly collected murine plasma and is an inactive precursor of the protease plasmin. It is activated to the serine protease plasmin by urokinase, streptokinase, or tissue plasminogen activator.
    Murine Plasminogen
  • HY-E70547A

    Biochemical Assay Reagents Cardiovascular Disease
    Murine Factor XIII is a natural coagulation factor present in plasma, composed of two identical α subunits and two identical β subunits .
    Murine Factor XIII
  • HY-E70085

    DNA/RNA Synthesis Infection
    Moloney murine leukemia virus RT is a monomeric reverse transcriptase from Moloney murine leukemia virus (MMLV). Moloney murine leukemia virus RT is a replicative polymerase that play an essential role in the life cycle of the retrovirus .
    Moloney murine leukemia virus RT
  • HY-NP145

    Biochemical Assay Reagents Metabolic Disease
    Epidermal Growth Factor, murine submaxillary gland is a biologically active polypeptide isolated from mouse submandibular gland. Epidermal Growth Factor, murine submaxillary gland is a mitogen that stimulates the growth of epithelial cells, fibroblasts and glial cells under various experimental conditions .
    Epidermal Growth Factor,murine submaxillary gland
  • HY-NP143

    Biochemical Assay Reagents Neurological Disease
    Nerve Growth Factor 2.5S, murine submaxillary gland is a neurotrophic polypeptide required for normal growth and development of sympathetic and embryonic sensory neurons and certain cholinergic neurons in the central nervous system. Nerve Growth Factor 2.5S, murine submaxillary gland has only β-subunit , and shows nerve growth-promoting activity .
    Nerve Growth Factor 2.5S,murine submaxillary gland
  • HY-155288

    Bcr-Abl Cancer
    DosatiLink-1 is an Abelson murine leukemia (ABL) enzyme inhibitor .
    DosatiLink-1
  • HY-NP144

    Biochemical Assay Reagents Neurological Disease
    Nerve Growth Factor 7S, murine submaxillary gland is an α2β2γ2 complex in which the β-NGF dimer (the active neurotrophin) is associated with two α-NGF and two γ-NGF subunits .
    Nerve Growth Factor 7S,murine submaxillary gland
  • HY-N1713

    Others Neurological Disease
    29-Nor-20-oxolupeol, extracted from Impatiens basamina, reduces NO levels in LPS-activated murine microglial cells with an IC50 of 44.21 µM .
    29-Nor-20-oxolupeol
  • HY-P2975

    Mouse laminin (Engelbreth-Holm-Swarm Murine sarcoma basement membrane)

    Endogenous Metabolite Biochemical Assay Reagents Neurological Disease
    Laminin β2 (Engelbreth-Holm-Swarm murine sarcoma basement membrane) is a crucial structural element in animal tissues, forming part of the scaffolding that supports tissue architecture. It interacts with type IV collagen through entactin and perlecan, connects to cell membranes via integrin receptors, dystroglycan complexes, and Lutheran blood group glycoproteins, and contains functional domains that facilitate collagen binding, cell adhesion, heparin interaction, and promote neurite outgrowth.
    Laminin β2 (Engelbreth-Holm-Swarm murine sarcoma basement membrane)
  • HY-N10445

    CD28 CD3 Inflammation/Immunology
    Maydispenoid A is a potent immunosuppressor. Maydispenoid A can inhibit anti-CD3/anti-CD28 mAbs activated and lipopolysaccharide activated murine splenocyte proliferation .
    Maydispenoid A
  • HY-N10446

    CD28 CD3 Inflammation/Immunology
    Maydispenoid B is a potent immunosuppressor. Maydispenoid B can inhibit anti-CD3/anti-CD28 mAbs activated and lipopolysaccharide activated murine splenocyte proliferation .
    Maydispenoid B
  • HY-146345

    Antibiotic Infection
    Antiviral agent 18 (Compound 5) is an anti-infection agent. Antiviral agent 18 results in good antiviral activity against murine norovirus. Antiviral agent 18 has the potential for the research of infectious and malignant diseases .
    Antiviral agent 18
  • HY-P1293

    iGluR Neurological Disease
    Conantokin G, a 17-amino-acid peptide, is a potent, selective and competitive antagonist of N-methyl-D-aspartate (NMDA) receptors. Conantokin G inhibits NMDA-evoked currents in murine cortical neurons with an IC50 of 480 nM. Conantokin G has neuroprotective properties .
    Conantokin G
  • HY-117365

    Epigenetic Reader Domain Cancer
    MI-1481 is a highly potent inhibitor of the Menin-MLL1 interaction with IC50 of 3.6 nM. MI-1481 markedly reduces cell growth of murine bone marrow cells transformed and inhibits leukemia progression .
    MI-1481
  • HY-P1293A

    iGluR Neurological Disease
    Conantokin G TFA, a 17-amino-acid peptide, is a potent, selective and competitive antagonist of N-methyl-D-aspartate (NMDA) receptors. Conantokin G TFA inhibits NMDA-evoked currents in murine cortical neurons with an IC50 of 480 nM. Conantokin G TFA has neuroprotective properties .
    Conantokin G TFA
  • HY-163327

    Others Neurological Disease
    pFBC ([ 18F]pEBC) is a covalent CLIP-tag radiotracer for detection of viral reporter gene transfer in the murine brain. pFBC can be used in neurobiological research .
    pFBC
  • HY-146344

    DNA/RNA Synthesis Infection
    Antiviral agent 17 is an anti-infection agent. Antiviral agent 17 retains its antiviral effect in a human replicon assay (EC50 = 0.015 μM). Antiviral agent 17 results in good antiviral activity against murine norovirus with an EC50 of 7 nM. . Antiviral agent 17 has the potential for the research of infectious and malignant diseases .
    Antiviral agent 17
  • HY-P99177

    SARS-CoV Infection Cardiovascular Disease
    Enibarcimab is a humanised murine monoclonal immunoglobulin G1 (IgG1) antibody, could be used for acute heart failure, COVID-19 infections and septic shock research .
    Enibarcimab
  • HY-P99336

    BI-RR 0001; Anti-Human IL6 Recombinant Antibody

    Integrin Neurological Disease Inflammation/Immunology
    Enlimomab (BI-RR 0001), a murine IgG2a monoclonal antibody to the human ICAM-1, inhibits leukocyte adhesion to the vascular endothelium, thereby decreasing leukocyte extravasation and inflammatory tissue injury. Enlimomab has anti-inflammatory effects, and can be used for stroke research .
    Enlimomab
  • HY-121726

    mTOR Autophagy Cardiovascular Disease
    3HOI-BA-01 is amTORinhibitor.3HOI-BA-01reduces infarct size and inducedautophagyin a murine myocardial ischemia/reperfusion injury model .
    3HOI-BA-01
  • HY-146344R

    Reference Standards DNA/RNA Synthesis Infection
    Antiviral agent 17 (Standard) is the analytical standard of Antiviral agent 17 (HY-146344). This product is intended for research and analytical applications. Antiviral agent 17 is an anti-infection agent. Antiviral agent 17 retains its antiviral effect in a human replicon assay (EC50 = 0.015 μM). Antiviral agent 17 results in good antiviral activity against murine norovirus with an EC50 of 7 nM. . Antiviral agent 17 has the potential for the research of infectious and malignant diseases .
    Antiviral agent 17 (Standard)
  • HY-145441

    Drug Derivative Cancer
    GEM–IB is the conjugate of gemcitabine (GEM)-5'-phosphate with ibandronate (IB). GEM–IB as a single agent or in combination with Docetaxel (DTX) demonstrates reduced tumor burden, preservation of the bone architecture, and improved the survival in a murine model of osteosarcoma (OS) .
    GEM–IB
  • HY-N0859B

    NO Synthase Neurological Disease
    Schisanchinin D is an NO release inhibitor found in the fruits of Schisandra chinensis. Schisanchinin D can inhibit the release of nitric oxide (NO) by lipopolysaccharide (LPS)-activated microglia in primary murine BV2 microglia cells. Schisanchinin D is promising for research of neurodegenerative diseases such as Alzheimer's disease (AD) .
    Schisanchinin D
  • HY-12836A

    IFNAR Inflammation/Immunology
    IFN alpha-IFNAR-IN-1 hydrochloride is a nonpeptidic, low-molecular-weight inhibitor of the interaction between IFN-α and IFNAR. IFN alpha-IFNAR-IN-1 hydrochloride inhibits modified Vaccinia virus ankara (MVA)-induced IFN-α responses in murine bone-marrow-derived, Flt3- L-differentiated pDC cultures (BM-pDCs) (IC50=2-8 μM) .
    IFN alpha-IFNAR-IN-1 hydrochloride
  • HY-151808

    Btk Cancer
    JS25 is a selective and covalent inhibitor of BTK that inactivates BTK with an IC50 value of 5.8 nM by chelating Tyr551. JS25 inhibits cancer cells proliferation, pronounces cell death, and promotes murine xenograft model of Burkitt’s lymphoma. JS25 effectively crosses the blood-brain barrier .
    JS25
  • HY-N1649

    Others Cancer
    2,3,2'',3''-Tetrahydroochnaflavone is a biflavonoid, which can be isolated from the leaves of Quintinia acutifolia. 2,3,2'',3''-Tetrahydroochnaflavone shows some cytotoxicity against P388 murine lymphocytic leukemia cells, with an IC50 of 8.2 µg/mL .
    2,3,2'',3''-Tetrahydroochnaflavone
  • HY-N1388
    Tussilagone
    1 Publications Verification

    Others Inflammation/Immunology
    Tussilagone, a major active component in Tussilago farfara, has anti-inflammatory effect. Tussilagone ameliorates inflammatory responses in dextran sulphate sodium-induced murine colitis. Tussilagone inhibits the inflammatory response and improves survival in cecal ligation and puncture (CLP)-induced septic mice .
    Tussilagone
  • HY-N14957

    Antibiotic Infection
    Clavicoronic acid is an avian myeloblastosis virus and Moloney murine leukemia virus reverse transcriptases inhibitor with Ki values of 130, 68 µM, respectively. Clavicoronic acid inhibits the multiplication of vesicular stomatitis virus by interfering with this virus's RNA-directed RNA-polymerase. Clavicoronic acid shows no cytotoxicity .
    Clavicoronic acid
  • HY-W272217

    n-Octacosane; NSC 5549

    Endogenous Metabolite Bacterial Inflammation/Immunology Cancer
    Octacosane is an endogenous metabolite with antibacterial activity. Octacosane shows high cytotoxicity against murine melanoma B16F10-Nex2 cells besides inducing protection against a grafted subcutaneous melanoma. Octacosane has the larvicidal activity against mosquito Culex quinquefasciatus with the LC50 concentration of 7.2 mg/l .
    Octacosane
  • HY-W272217R

    n-Octacosane (Standard); NSC 5549 (Standard)

    Reference Standards Endogenous Metabolite Bacterial Inflammation/Immunology Cancer
    Octacosane (Standard) is the analytical standard of Octacosane. This product is intended for research and analytical applications. Octacosane is an endogenous metabolite with antibacterial activity. Octacosane shows high cytotoxicity against murine melanoma B16F10-Nex2 cells besides inducing protection against a grafted subcutaneous melanoma. Octacosane has the larvicidal activity against mosquito Culex quinquefasciatus with the LC50 concentration of 7.2 mg/l .
    Octacosane (Standard)
  • HY-N1388R

    Reference Standards Others Inflammation/Immunology
    Tussilagone (Standard) is the analytical standard of Tussilagone. This product is intended for research and analytical applications. Tussilagone, a major active component in Tussilago farfara, has anti-inflammatory effect. Tussilagone ameliorates inflammatory responses in dextran sulphate sodium-induced murine colitis. Tussilagone inhibits the inflammatory response and improves survival in cecal ligation and puncture (CLP)-induced septic mice .
    Tussilagone (Standard)
  • HY-114366

    CXCR Others
    BC-1485 is a small molecule inhibitor of Fibrosis-inducing E3 ligase 1 (FIEL1). BC-1485 protects PIAS4 from ubiquitin-mediated degradation. BC-1485 decreases α-SMA, BAL and CXCL1. BC-1485 ameliorates fibrotic lung injury in murine models .
    BC-1485
  • HY-161921

    Fungal Infection
    Antifungal agent 108 (compound 14d), an original imidazo[1,2-b]pyridazine derivative, shows potent antifungal activity against Madurella mycetomatis (MM55 strain) with an IC50 of 0.9 μM. Antifungal agent 108 exhibits an IC50 of 14.3 μM on cell viability of NIH-3T3 murine fibroblast .
    Antifungal agent 108
  • HY-19577

    PTT119

    DNA Alkylator/Crosslinker Infection Cancer
    Ambamustine (PTT119) is a new bifunctional alkylating agent and induces DNA damage by alkylating mechanisms. Ambamustine interferes with late steps in murine mammary tumor virus (MuMTV) processing and maturation and reduces production of the B-type retrovirus MuMTV. Ambamustine possesses cytolytic and antiviral activities .
    Ambamustine
  • HY-170835

    Beta-lactamase Bacterial Infection Inflammation/Immunology
    NDM-1 inhibitor-7 (Compound A8) is a NDM-1 inhibitor, with IC50 of 10.284 μM. NDM-1 inhibitor-7 restores the ability of MEM to penetrate the cell wall of gram-negative bacteria. NDM-1 inhibitor-7 effectively restores the antibacterial activity of MEM against NDM-1-positive Escherichia coli. NDM-1 inhibitor-7 demonstrates strong efficacy in both the Galleria mellonella infection model and murine peritonitis infection model .
    NDM-1 inhibitor-7
  • HY-160142

    Btk Cancer
    UBX-382 is an orally available proteolysis-targeting chimeras (PROTACs) that target BTK to inactivate B-cell receptor signaling. UBX-382 shows superior degradation activity for wild-type and mutant BTK proteins and shows anti-cancer activity in murine xenograft models of TMD-8 cells .
    UBX-382
  • HY-N10337

    (-)-Norjuziphine

    Drug Derivative Cancer
    Norjuziphine ((-)-Norjuziphine) is an alkaloid found in the lotus flower (Nelumbo nucifera). Norjuziphine inhibits the melanogenesis of murine B16 melanoma 4A5 cells stimulated by Theophylline (HY-B0809) (IC50=14.4 μM). Norjuziphine is promising for research of skin whitening and related skin pigmentation diseases .
    Norjuziphine
  • HY-120241

    K 251-1

    Phosphodiesterase (PDE) Cancer
    Reticulol (K 251-1) is an inhibitor of cyclic adenosine 3', 5'-monophosphate phosphodiesterase. Reticulol shows antitumor activity independent with cell cycle arrest or apoptosis. Reticulol inhibits cell growth of murine melanoma cells and human lung tumor cells. Reticulol protects its lung metastasis via the bloodstream by inhibiting the growth of B16F10 melanoma .
    Reticulol
  • HY-173472

    Bacterial Beta-lactamase Infection
    MBL-IN-5 is a metallo-β-lactamase (MBL) inhibitor. MBL-IN-5 inhibits three clinically relevant B1 subfamily MBLs (NDM-1, VIM-1, and IMP-1) with IC50s of 0.05  nM, 14  nM and 21 nM respectively. MBL-IN-5 remarkably enhances carbapenems’ effectiveness against MBL-producing clinical strains and significantly reduces the bacterial load in a neutropenic murine thigh infection model combined with the IPM antibiotic .
    MBL-IN-5
  • HY-174985

    Bacterial Infection
    Anti-MRSA agent 32 (Compound 26) is an orally active and selective SaClpP (Staphylococcus aureus ClpP protease) activator with an EC50 value of 0.98 μM. Anti-MRSA agent 32 activates SaClpP to abnormally degrade bacterial proteins, inhibiting the proliferation of Staphylococcus aureus. Anti-MRSA agent 32 promotes wound healing in a murine skin infection model. Anti-MRSA agent 32 is promising for research of infectious diseases such as methicillin-resistant Staphylococcus aureus (MRSA) infections .
    Anti-MRSA agent 32
  • HY-112041
    Unesbulin
    3 Publications Verification

    PTC596

    BMI1 Apoptosis Cancer
    Unesbulin (PTC596) is an orally active and selective B-cell-specific Moloney murine leukemia virus integration site 1 (BMI-1) inhibitor. Unesbulin downregulates MCL-1 and induces p53-independent mitochondrial apoptosis in acute myeloid leukemia (AML) cells. Unesbulin has anti-leukemic activity .
    Unesbulin
  • HY-125662A

    Reactive Oxygen Species (ROS) Apoptosis Metabolic Disease
    BMX-001, a novel redox-active metalloporphyrin, improves islet function and engraftment in a murine transplant model. BMX-001 reduces apoptosis in human and murine islets. BMX-001 significantly improves static-glucose stimulated insulin secretion (sGSIS) responses in murine islets. BMX-001 can significantly restore euglycemia in murine islet studies in the presence of the MnSOD. BMX-001 reduces the generation of ROS in a murine islet isolation and culture model .
    BMX-001
  • HY-174980

    Bacterial Infection
    KPC-2-IN-3 (Compound 3b) is a KPC-2 inhibitor with IC50 of 0.533  μM and Kiof 0.194  μM. KPC-2-IN-3 has an antimicrobial activity against carbapenem-resistant K. pneumonia K47-25 and reduces bacterial count with a postantibiotic effect in synergy with Meropenem (HY-13678). KPC-2-IN-3 significantly reduces lung bacterial load in a murine pneumonia model .
    KPC-2-IN-3
  • HY-111662

    NOD-like Receptor (NLR) Inflammation/Immunology
    Fc 11a-2, a benzimidazole compound, is an orally active and potent NLRP3 inflammasome inhibitor. Fc 11a-2 restrains the formation of NLRP3 inflammasome by inhibiting activation of caspase-1 and thus the activation of IL-1b/IL-18. Fc 11a-2 prevents the development of Dextran sulfate sodium (DSS; HY-116282C)-induced murine experimental colitis .
    Fc 11a-2
  • HY-120944

    MMP Inflammation/Immunology
    BAY-7598 is a potent, orally bioavailable, and selective MMP12 inhibitor with IC50s of 0.085, 0.67 and 1.1 nM for human MMP12, murine MMP12, and rat MMP12, respectively .
    BAY-7598
  • HY-106382

    HIV CMV Infection Cancer
    PMEDAP is a potent inhibitor of human immunodeficiency virus (HIV) replication. PMEDAP has anti-murine cytomegalovirus (MCMV) activity. PMEDAP is a very potent inhibitor of Moloney murine sarcoma virus (MSV)-induced tumor formation and associated mortality .
    PMEDAP

Inquiry Online

Your information is safe with us. * Required Fields.

Salutation

 

Country or Region *

Applicant Name *

 

Organization Name *

Department *

     

Email Address *

 

Product Name *

Cat. No.

 

Requested quantity *

Phone Number *

     

Remarks

Inquiry Online

Inquiry Information

Product Name:
Cat. No.:
Quantity:
MCE Japan Authorized Agent: