1. Search Result
Search Result
Results for "

viral protein

" in MedChemExpress (MCE) Product Catalog:

116

Inhibitors & Agonists

5

Screening Libraries

1

Biochemical Assay Reagents

4

Peptides

3

Inhibitory Antibodies

19

Natural
Products

24

Recombinant Proteins

1

Isotope-Labeled Compounds

22

Antibodies

3

Oligonucleotides

Cat. No. Product Name Target Research Areas Chemical Structure
  • HY-109045A

    BTA074 hydrochloride; AP 611074 hydrochloride

    E1/E2/E3 Enzyme HPV Infection
    Teslexivir (BTA074) hydrochloride is a potent antiviral agent. Teslexivir hydrochloride is a potent and selective inhibitor of the interaction between two essential viral proteins, E1 and E2, an association that is a necessary step in the DNA replication and thus viral production for Human Papilloma Virus (HPV) 6 and 11. Teslexivir hydrochloride can be used for condyloma research .
    Teslexivir hydrochloride
  • HY-146226

    Enterovirus Infection
    Viral 2C protein inhibitor 1 (compound 6aw) is a potent and broad-spectrum enterovirus antiviral agent, inhibiting viral 2C protein. Viral 2C protein inhibitor 1 inhibits multiple strains of EV-D68, EV-A71 and CVB3 with EC50s of 0.1~3.6 µM, and exhibits high selectivity index and relatively low cytotoxicity .
    Viral 2C protein inhibitor 1
  • HY-19874

    RSV Infection
    RFI-641 is a selective inhibitor of the respiratory syncytial virus (RSV), with an IC50 of 50 nM. RFI-641 inhibit binding and fusion of enveloped virus via interaction with the viral fusion protein .
    RFI-641
  • HY-105721

    SARS-CoV Infection
    Aranotin strongly binds to Nsp15 viral protein. Aranotin can be used as promising SARS-CoV-2 replication strong inhibitor. Aranotin has the potential for COVID-19 research .
    Aranotin
  • HY-109045

    BTA074; AP 611074

    E1/E2/E3 Enzyme HPV Infection
    Teslexivir (BTA074) is a potent antiviral agent. Teslexivir is a potent and selective inhibitor of the interaction between two essential viral proteins, E1 and E2, an association that is a necessary step in the DNA replication and thus viral production for Human Papilloma Virus (HPV) 6 and 11. Teslexivir can be used for condyloma research .
    Teslexivir
  • HY-157236

    Biochemical Assay Reagents Others
    AEX Anion-exchange resin 1 is a strong anion exchange chromatography resin, based on monodisperse polystyrene/divinylbenzene (PS-DVB), with a particle size of 50 μm and an ionic ligand of –CH2N + (CH3)3. AEX Anion-exchange resin 1 can be used for the separation and purification of biological macromolecules such as proteins, antibodies, and viral vaccines.
    AEX Anion-exchange resin 1
  • HY-174998

    HIV HIV Protease Infection
    HIV-1 protease-IN-15 (Compound 27) is an orally active and selective inhibitor targeting HIV-1 protease with a pIC50 value of 9.347. HIV-1 protease-IN-15 inhibits HIV protein maturation, blocks viral replication. HIV-1 protease-IN-15 is promising for research of HIV-1 infection .
    HIV-1 protease-IN-15
  • HY-152028

    HSP Infection Neurological Disease Inflammation/Immunology Cancer
    HSP90-IN-19 is an effective heat shock protein 90 (Hsp90) inhibitor. HSP90-IN-19 has effective Hsp90 inhibitory activity with an IC50 value of 0.27 μM. HSP90-IN-19 can be used for the research of viral infection, neurodegenerative disease, and inflammation .
    HSP90-IN-19
  • HY-152027

    HSP Apoptosis Infection Neurological Disease Inflammation/Immunology Cancer
    HSP90-IN-18 is an effective heat shock protein 90 (Hsp90) inhibitor. HSP90-IN-18 has effective Hsp90 inhibitory activity with an IC50 value of 0.39 μM. HSP90-IN-18 can be used for the research of viral infection, neurodegenerative disease, and inflammation .
    HSP90-IN-18
  • HY-145850

    Enterovirus Infection
    EV-A71-IN-1 is a human enterovirus A71 (EV-A71) capsid protein inhibitor with an EC50 of 0.27 μM against EV-A71. EV-A71-IN-1 is a capsid binder that blocks the interaction between the viral VP1 and the host receptor hSCARB2. EV-A71-IN-1 inhibits a series of different human enteroviruses without significant cytotoxicity (CC50>56.2 μM) .
    EV-A71-IN-1
  • HY-171788

    N-myristoyltransferase Cancer
    NMT-IN-8 (Compound Ex.129) is an orally active and highly selective inhibitor of N-myristoyl transferase (NMT) with an IC50 value of <10 nM. NMT-IN-8 binds to the peptide binding pocket of NMT, blocking its catalyzed protein N-myristoylation to interfere with key pathways such as protein trafficking, signal transduction, and viral replication. NMT-IN-8 is promising for research of oncology (e.g., MYC-addicted cancers, B-cell lymphoma) and infectious diseases (e.g., malaria, HIV, rhinovirus infection) .
    NMT-IN-8
  • HY-148170

    EBV DNA/RNA Synthesis Nucleoside Antimetabolite/Analog Infection
    L-I-OddU, a L-5'-halo- dioxolane nucleoside analogue, is a potent and selective anti-Epstein-Barr virus (EBV) agent with an EC50 value of 0.03μM. L-I-OddU has low cytotoxicity with a CC50 value of 1000 nM. L-I-OddU has antiviral activity by suppressing replicative EBV DNA and viral protein synthesis .
    L-I-OddU
  • HY-174814

    Enterovirus Infection
    Jun15716 is an Enterovirus (EVs) 2C protein (EVs 2C) inhibitor with Kis of 15.9, 44.2 and 17.8 μM for EV-D68, EV-A71 and CVB3, respectively. Jun15716 has a potent antiviral activity against EV-D68 US/MO/14-18947 and CVB3 Nancy cells (EC50s of 1.0 and 0.7 μM, respectively). Jun15716 can be used for viral infections research, such as meningitis, hand, foot and mouth disease (HFMD) and viral myocarditis .
    Jun15716
  • HY-174815

    Enterovirus Infection
    Jun15799 is an Enterovirus (EVs) 2C protein (EVs 2C) inhibitor with Kis of 0.8, 21.1 and 3.0 μM for EV-D68, EV-A71 and CVB3, respectively. Jun15799 has a significant antiviral activity against EV-D68 US/MO/14-18947, EV-A71 Tainan/4643/1998 and CVB3 Nancy cells (EC50s of 0.3, 11.4 and 0.3 μM, respectively). Jun15799 can be used for viral infections research, such as meningitis, hand, foot and mouth disease (HFMD) and viral myocarditis .
    Jun15799
  • HY-124512

    Pentaacetylquercetin

    RSV Infection Inflammation/Immunology
    Quercetin pentaacetate could interact with F-protein with lower binding energy and better stability to block viral adhesion. Quercetin pentaacetate interacts with RSV and inhibit the viral adhesion on cell surface .
    Quercetin pentaacetate
  • HY-162512

    CCR HIV Infection
    CB-0821 is a high affinity CCR5 inhibitor with a Ki of 0.04 nM. CB-0821 binds efficiently to the hydrophobic pocket of the CCR5 protein, to inhibit the interactions between viral protein and CCR5, thereby inhibiting viral entry. CB-0821 has the potential for anti-HIV research .
    CB-0821
  • HY-106312A

    LY122772

    Enterovirus Infection
    Enviroxime (LY122772) is an antiviral compound that inhibits the replication of rhinoviruses and enteroviruses. Enviroxime blocks the replication of plus-strand viral RNA by targeting the viral 3A coding region. Enviroxime can be a useful tool for investigating the natural function of the 3A protein .
    Enviroxime
  • HY-172553

    Virus Protease SARS-CoV Infection
    AS-0017445 is an inhibitor targeting the main protease of both the current coronavirus and the virus that caused the Middle East Respiratory Syndrome (MERS) outbreak. AS-0017445 inhibits the viral protein processing in host cells and thus prevents viral replication .
    AS-0017445
  • HY-153810

    JNJ-1802

    Virus Protease Flavivirus Dengue Virus Infection
    Mosnodenvir (JNJ-1802) is an orally active pan serotype dengue virus (DENV) inhibitor, with EC50 values ranging from 0.057 to 11 nM for four dengue virus (DENV) serotypes. Mosnodenvir blocks viral replication by inhibiting the formation of complexes between two viral proteins, nonstructural protein 3 (NS3) and NS4B, thereby preventing the formation of new viral RNA. Mosnodenvir exhibits picomolar to nanomolar antiviral activity in vitro and has antiviral efficacy in mice and non-human primates .
    Mosnodenvir
  • HY-148348

    HBV Infection
    AB-836 is an orally active HBV capsid inhibitor. AB-836 inhibits viral replication by interacting with HBV core protein .
    AB-836
  • HY-163029

    Cathepsin SARS-CoV Infection
    CTSLCTSB-IN-1 (compound 212-148) is a bispecific inhibitor of host viral spike cleaver proteins CTSL/CTSB and TMPRSS2 with IC50s of 2.13/64.07 nM and 1.38 μM, respectively. CTSLCTSB-IN-1 blocks two relevant SARS-CoV-2 viral entry pathways by inhibiting the viral spike cleavage and can be applied to anti-SARS-CoV-2 research .
    CTSL/B-IN-1
  • HY-147314

    HIV Src Infection
    HIV-IN-6 is a HIV-Ⅰ viral replication inhibitor by targeting Src family kinases (SFK) that interact with Nef protein of the virus, such as Hck .
    HIV-IN-6
  • HY-139850

    HIV Infection
    GPS491 (EC50 = 0.47 μM) suppresses expression of the HIV-1 structural protein Gag and alters HIV-1 RNA accumulation, decreasing the abundance of RNAs encoding the structural proteins while increasing levels of viral RNAs encoding the regulatory proteins.
    GPS491
  • HY-172760

    Virus Protease SARS-CoV Infection
    CIM-834 is an orally active and selective inhibitor targeting the coronavirus membrane protein (M protein), which potently blocks viral assembly against SARS-CoV-2 and SARS-CoV. CIM-834 binds to the short form of the M protein (Mshort) in a non-covalent manner, stabilizing Mshort and preventing its conformational switch to the long form (Mlong) required for virion assembly, thereby inhibiting viral particle formation. CIM-834 is promising for research of COVID-19 and other coronavirus infections .
    CIM-834
  • HY-162807

    TMV Infection
    TMV-IN-10 (compound 4h) is an arecoline derivative with anti-tobacco mosaic virus (TMV) activity (EC50=146 µg/mL). TMV-IN-10 can be used in research on controlling crop pests and diseases and improving crop yields by acting on the viral coat protein (CP) to cause viral fragmentation .
    TMV-IN-10
  • HY-170523

    SARS-CoV DNA Methyltransferase Infection
    RU-0415529 is an orally active inhibitor for SARS-CoV-2 nonstructural protein 14 (NSP14) with an IC50 of 356 nM. RU-0415529 binds to the SAH-stabilized cap binding pocket, inhibits viral RNA methylation and the viral replication. RU-0415529 exhibits anti-infectious activity in mouse models .
    RU-0415529
  • HY-119210

    HIV Infection
    ZINC04177596 is a potent HIV-negative factor (HIV-Nef) protein inhibitor. Nef is an accessory gene product of HIV and has an imperative role in viral replication and AIDS pathogenesis .
    ZINC04177596
  • HY-176433

    Flavivirus Infection
    NSC-323241 is a potent STT3A-mediated mega protein complex assembly inhibitor. NSC-323241 disrupts he endoplasmic reticulum (ER) mega complex nucleated by STT3A during dengue virus (DENV) and Zika virus (ZIKV) infection. NSC-323241 targets the binding of STT3A subcomplex with viral nonstructural proteins (e.g., NS2B, NS3) and host translocon proteins, disrupting the formation of viral replication microenvironment. NSC-323241 is promising for research of flavivirus infection, such as dengue fever and Zika virus .
    NSC-323241
  • HY-113761

    Filovirus Infection
    ASN03576800 could be a potent inhibitor for Ebola virus matrix protein VP40 in process of viral assembly and budding process. ASN03576800 occupies the RNA binding region of VP40 .
    ASN03576800
  • HY-107745

    Opioid Receptor Flavivirus Infection Neurological Disease
    SDM25N hydrochloride, a δ-opioid receptor antagonist, is a potent DENV inhibitor. SDM25N hydrochloride targets the viral NS4B protein and restricts genomic RNA replication .
    SDM25N hydrochloride
  • HY-102077

    HIV Infection
    SAMT-247 is a microbicide that selectively inactivate the viral nucleocapsid protein NCp7, causing zinc ejection and preventing RNA encapsidation. SAMT-247 shows good antiviral activity .
    SAMT-247
  • HY-N2000

    HIV Infection Inflammation/Immunology Cancer
    Bellidifolin is a xanthone isolated from the stems of Swertia punicea, with hepatoprotective, hypoglycemic, anti-oxidation, anti-inflammatory and antitumor activities . Bellidifolin also acts as a viral protein R (Vpr) inhibitor .
    Bellidifolin
  • HY-121663

    Dengue Virus Infection
    ST-148 is a novel small molecule compound that has potent inhibitory effects against all four dengue virus serotypes. In the nonlethal AG129 mouse dengue virus infection model, ST-148 significantly reduced viremia and viral load in vital organs and tended to reduce plasma cytokine levels. Compound resistance was associated with the dengue virus capsid (C) gene, and the direct interaction of ST-148 with the C protein was presumed to be achieved through the protein's built-in fluorescence change in the presence of the compound. Therefore, ST-148 appears to interact with the dengue virus C protein and inhibit one or more unique steps of the viral replication cycle.
    ST-148
  • HY-148768

    HBV Inflammation/Immunology
    AB-506 is an orally active inhibitor of HBV replication targeting the viral core protein. AB-506 can bind to HBV core protein, accelerate capsid assembly and inhibit HBV pgRNA encapsidation. AB-506 can be used in chronic hepatitis B (CHB) research .
    AB-506
  • HY-N3187

    Flavivirus Dengue Virus Fungal Bacterial Histamine Receptor Infection Neurological Disease Inflammation/Immunology Cancer
    Nimbin is an orally active intermediate limonoid found in Azadirachta. Nimbin prevents tau aggregation and increases cell viability. Nimbin is effective inhibits the envelope protein of dengue virus. Nimbin has anti-inflammatory, antipyretic, antifungal, antihistamine, antiseptic, antioxidant, anti-cancer and anti-viral properties. Nimbin can across blood-brain barrier. Nimbin is promising for research of neurodegenerative diseases and viral infections .
    Nimbin
  • HY-168999

    Tomato Spotted Wilt Virus (TSWV) Infection
    TSWV-IN-2 (Compound Z9) is an inhibitor of TSWV N protein, with an EC50 of 65.3 μg/mL against TSWV. TSWV-IN-2 has broad-spectrum antiviral activity against plant viruses. TSWV-IN-2 targets the TSWV N protein, interferes with the formation of condensates between the N protein and RNA, and inhibits the replication of viral ribonucleoproteins .
    TSWV-IN-2
  • HY-N2036

    TNF Receptor Enterovirus Bacterial Infection
    Mosloflavone is a flavonoid isolated from Scutellaria baicalensis Georgi with ?anti-EV71 activity. Mosloflavone? inhibits VP2 virus replication and protein expression during the initial stage of virus infection and inhibits viral VP2 capsid protein synthesis. Mosloflavone is a promising biocide and inhibits P. aeruginosa virulence and biofilm formation.
    Mosloflavone
  • HY-W555382

    2-Nonylquinolin-4(1H)-one

    HCV Infection
    Pseudane IX, a compound isolated from the leaves of Ruta angustifolia, has strong anti-HCV activity with an IC50 value of 1.4 μg/mL. Pseudane IX reduces HCV RNA replication and viral protein synthesis levels .
    Pseudane IX
  • HY-128744
    Phosphonoacetic acid
    1 Publications Verification

    Endogenous Metabolite Orthopoxvirus HSV DNA/RNA Synthesis Infection
    Phosphonoacetic acid is an endogenous metabolite and antiviral agent. Phosphonoacetic acid is active against orthopoxviruses and herpes viruses. Phosphonoacetic acid can inhibit HSV DNA synthesis and virus-specific DNA polymerase activity, and affect the synthesis of late viral proteins .
    Phosphonoacetic acid
  • HY-138941

    C12E8

    Influenza Virus Infection
    Octaethylene glycol monododecyl ether (C12E8) is an non-ionic detergent that can be used for membrane protein extraction. Octaethylene glycol monododecyl ether can solubilize the viral membrane of intact influenza virus .
    Octaethylene glycol monododecyl ether
  • HY-B1268
    Docusate Sodium
    1 Publications Verification

    Dioctyl sulfosuccinate sodium salt

    HSV Others
    Docusate Sodium (Dioctyl sulfosuccinate sodium salt) is one of the main components in stool softeners. Docusate Sodium is a sulfated surfactant and may inactivate viral pathogens by disrupting viral envelopes and/or denaturing/disassociating proteins. Docusate Sodium is effective in vitro against wild type and drug-resistant strains of HSV type 1 and 2. Docusate Sodium is an obesogen. Docusate Sodium with developmental exposure leads to increased adult adiposity, inflammation, metabolic disorder and dyslipidemia in offspring fed a standard diet in mice .
    Docusate Sodium
  • HY-B0751

    Amebacilin; NSC9168

    Parasite HIV Antibiotic Infection
    Fumagillin(NSC9168) is an antimicrobial compound first isolated in 1949 from the fungus Aspergillus fumigatu. Fumagillin can inhibits HIV‐1 infection through the inhibition of HIV-1 viral protein R (Vpr) activity.
    Fumagillin
  • HY-172775

    Orthopoxvirus Infection
    Spirovirimat (Compound 7) is a potent Monkeypox virus (MPXV) p37 protein inhibitor with an IC50 value of 35 nM. Spirovirimat blocks the formation of extracellular virions by inhibiting viral membrane wrapping. Spirovirimat is promising for research of Monkeypox virus infections .
    Spirovirimat
  • HY-N0842
    Bevirimat
    1 Publications Verification

    PA-457; MPC-4326; YK FH312

    Virus Protease Infection
    Bevirimat (PA-457, MPC-4326, YK FH312) is an inhibitor of HIV-1 viral particle maturation.Bevirimat specifically inhibits the final rate-limiting step in Gag processing, preventing the release of the mature capsid protein (CA) from its precursor (CA-SP1), resulting in the production of immature non-infectious viral particles. Bevirimat can be used in HIV-1 infection studies .
    Bevirimat
  • HY-147217

    ISIS 505358

    HBV Infection
    Bepirovirsen is an antisense oligonucleotide targeting all HBV messenger RNAs. Bepirovirsen leads to reductions in HBV-derived RNAs, HBV DNA and viral proteins. Bepirovirsen can be used for the research of chronic HBV infection. Bepirovirsen binding site sequence (GCACTTCGCTTCACCTCTGC) .
    Bepirovirsen
  • HY-111026

    Influenza Virus Infection
    PPQ-581 is an anti-influenza agent with an EC50 of 1 μM for preventing virus-induced cytopathic effects. PPQ-581 inhibits viral protein synthesis. PPQ-581 blocks the RNP nuclear export and cytoplasmic RNP aggregation .
    PPQ-581
  • HY-136782

    Flavivirus Dengue Virus Infection
    ST-148 maleate is a potent and orally active DENV inhibitor. ST-148 maleate shows antiviral efficacy and low cell toxicity. ST-148 alters the interaction between lipid droplets and the C protein, thereby inhibiting viral replication. .
    ST-148 maleate
  • HY-P99346

    CT-P59

    SARS-CoV Angiotensin-converting Enzyme (ACE) Infection
    Regdanvimab (CT-P59) is a human monoclonal antibody that targets the receptor-binding domain of SARS-CoV-2 spike protein, blocking interaction with ACE2 for viral entry. Regdanvimab can be used for the research of COVID-19 .
    Regdanvimab
  • HY-148328

    Casein Kinase Infection Inflammation/Immunology Cancer
    CK2-IN-4 (compound 5) is a protein kinase (CK2) inhibitor (IC50=8.6 µM). CK2-IN-4 has good potential for research in the areas of cancer, viral infections and glomerulonephritis .
    CK2-IN-4
  • HY-16957

    HCV HIV Infection
    LJ001 is a broad-spectrum and orally active antiviral agent. LJ001 exerts antiviral activities by binding to viral membranes. LJ001 inhibits TGEV and PDCoV infection. LJ001 decreases TGEV N and PDCoV N-protein expression .
    LJ001

Inquiry Online

Your information is safe with us. * Required Fields.

Salutation

 

Country or Region *

Applicant Name *

 

Organization Name *

Department *

     

Email Address *

 

Product Name *

Cat. No.

 

Requested quantity *

Phone Number *

     

Remarks

Inquiry Online

Inquiry Information

Product Name:
Cat. No.:
Quantity:
MCE Japan Authorized Agent: