1. Anti-infection
  2. HBV
  3. Bepirovirsen sodium

Bepirovirsen sodium  (Synonyms: ISIS 505358 sodium)

Cat. No.: HY-147217A Purity: 98.44%
Handling Instructions Technical Support

Bepirovirsen (ISIS 505358) sodium is an antisense oligonucleotide targeting all HBV messenger RNAs. Bepirovirsen sodium leads to reductions in HBV-derived RNAs, HBV DNA and viral proteins. Bepirovirsen sodium can be used for the research of chronic HBV infection. Bepirovirsen sodium binding site sequence (GCACTTCGCTTCACCTCTGC).

For research use only. We do not sell to patients.

DNA, d(P-thio)([2′-O-(2-methoxyethyl)]rG-[2′-O-(2-methoxyethyl)]m5rC-[2′-O-(2-methoxyethyl)]rA-[2′-O-(2-methoxyethyl)]rG-[2′-O-(2-methoxyethyl)]rA-G-G-T-G-A-A-G-m5C-G-A-[2′-O-(2-methoxyethyl)]rA-[2′-O-(2-methoxyethyl)]rG-[2′-O-(2-methoxyethyl)]m5rU-[2′-O-(2-methoxyethyl)]rG-[2′-O-(2-methoxyethyl)]m5rC), sodium salt

Bepirovirsen sodium Chemical Structure

CAS No. : 2563929-84-8

Size Price Stock Quantity
1 mg In-stock
5 mg In-stock
10 mg In-stock
50 mg   Get quote  
100 mg   Get quote  

* Please select Quantity before adding items.

This product is a controlled substance and not for sale in your territory.

Customer Review

Based on 1 publication(s) in Google Scholar

Other Forms of Bepirovirsen sodium:

Top Publications Citing Use of Products
  • Biological Activity

  • Purity & Documentation

  • References

  • Customer Review

Description

Bepirovirsen (ISIS 505358) sodium is an antisense oligonucleotide targeting all HBV messenger RNAs. Bepirovirsen sodium leads to reductions in HBV-derived RNAs, HBV DNA and viral proteins. Bepirovirsen sodium can be used for the research of chronic HBV infection. Bepirovirsen sodium binding site sequence (GCACTTCGCTTCACCTCTGC)[1][2][3].

In Vitro

Bepirovirsen sodium (16-250 nM, 96 h) reduces levels of HBV RNA transcripts in HBV-expressing HepG cells[3].

MedChemExpress (MCE) has not independently confirmed the accuracy of these methods. They are for reference only.

In Vivo

Bepirovirsen sodium (22 and 50 mg/kg, s.c., twice weekly for week 1 and once weekly for weeks 2-4) reduces hepatic RNA transcripts, subsequent production of HBV DNA, and associated HBV serum antigens in HBV-transgenic mice[3].

MedChemExpress (MCE) has not independently confirmed the accuracy of these methods. They are for reference only.

Animal Model: HBV-transgenic mice[3]
Dosage: 22 and 50 mg/kg
Administration: s.c., twice weekly for week 1 and once weekly for weeks 2-4
Result: Dose-dependently reduced hepatic expression of HBV RNA in HBV transgenic mice and reduced levels of all cytoplasmic hepatitis B core antigen in HBV-transgenic mice.
Clinical Trial
Molecular Weight

7762.00

Formula

C230H290N88Na19O115P19S19

CAS No.
Appearance

Solid

Color

White to off-white

SMILES

[Bepirovirsen (sodium)]

Shipping

Room temperature in continental US; may vary elsewhere.

Storage

-20°C, sealed storage, away from moisture

*In solvent : -80°C, 6 months; -20°C, 1 month (sealed storage, away from moisture)

Purity & Documentation

Purity: 98.44%

References
  • No file chosen (Maximum size is: 1024 Kb)
  • If you have published this work, please enter the PubMed ID.
  • Your name will appear on the site.

Bepirovirsen sodium Related Classifications

  • Molarity Calculator

  • Dilution Calculator

The molarity calculator equation

Mass (g) = Concentration (mol/L) × Volume (L) × Molecular Weight (g/mol)

Mass   Concentration   Volume   Molecular Weight *
= × ×

The dilution calculator equation

Concentration (start) × Volume (start) = Concentration (final) × Volume (final)

This equation is commonly abbreviated as: C1V1 = C2V2

Concentration (start) × Volume (start) = Concentration (final) × Volume (final)
× = ×
C1   V1   C2   V2
Help & FAQs
  • Do most proteins show cross-species activity?

    Species cross-reactivity must be investigated individually for each product. Many human cytokines will produce a nice response in mouse cell lines, and many mouse proteins will show activity on human cells. Other proteins may have a lower specific activity when used in the opposite species.

Your Recently Viewed Products:

Inquiry Online

Your information is safe with us. * Required Fields.

Product Name

 

Requested Quantity *

Applicant Name *

 

Salutation

Email Address *

 

Phone Number *

Department

 

Organization Name *

City

State

Country or Region *

     

Remarks

Bulk Inquiry

Inquiry Information

Product Name:
Bepirovirsen sodium
Cat. No.:
HY-147217A
Quantity:
MCE Japan Authorized Agent: