Search Result

Results for "

RNA binding protein

" in MedChemExpress (MCE) Product Catalog:

By Targets:	DNA/RNA Synthesis (15) AAK1 (1) Androgen Receptor (1) Antibiotic (21) Apoptosis (5) Bacterial (23) Bcl-2 Family (1) c-Myc (1) CDK (1) Cyclin G-associated Kinase (GAK) (1) DNA Methyltransferase (2) Endogenous Metabolite (10) Enterovirus (1) Filovirus (1) HBV (2) HCV (1) HIV (2) HSV (9) HuR (5) Insulin Receptor (1) Isotope-Labeled Compounds (6) LIM Kinase (LIMK) (1) Liposome (1) MicroRNA (8) Molecular Glues (2) Parasite (1) PROTACs (2) Pyroptosis (1) Salt-inducible Kinase (SIK) (1) SARS-CoV (4) Toll-like Receptor (TLR) (1) Topoisomerase (1) Wee1 (1) Wnt (1)
By Research Areas:	Cancer (25) Infection (32) Inflammation/Immunology (2) Neurological Disease (1)
Oligonucleotides:	Aptamers (2) mRNA (2) Antisense Oligonucleotides (2)

Inhibitors & Agonists

Screening Libraries

Biochemical Assay Reagents

Peptides

Natural
Products

Recombinant Proteins

Isotope-Labeled Compounds

Antibodies

Oligonucleotides

Targets Recommended: RNA MTase DNA/RNA Synthesis Emopamil Binding Protein Small Interfering RNA (siRNA) Penicillin-binding protein (PBP) Cdc42-binding kinase ATP-binding cassette (ABC) transporters Oxysterol-binding Protein-related Protein (ORP) FKBP FABP Transthyretin (TTR) Ligands for Target Protein for PROTAC YB-1 SDCBP GHR P-glycoprotein

Cat. No.	Product Name	Target	Research Areas	Chemical Structure

HY-138652

L-Histidine benzyl ester bistosylate	Bacterial	Others
L-Histidine benzyl ester bistosylate could play a role in the activation of HutP (an RNA-binding protein) .

HY-119734

Gossypolone	DNA/RNA Synthesis	Cancer
Gossypolone is an RNA-binding protein Musashi-1 inhibitor with a K_i of 12 nM. Gossypolone disrupts the Musashi-numb RNA interaction and directly binds to the RBD1 of MSI1 protein. Gossypolone can be used for the research of cancer .

HY-124648

SMN-C2	DNA/RNA Synthesis	Inflammation/Immunology
SMN-C2, an analog of RG-7916, is a selective modulator of SMN2 gene splicing that acts by binding SMN2 pre-mRNA, thereby increasing far upstream element binding protein 1 (FUBP1) and KH-spliced RNA binding Protein affinity regulator protein (KHSRP) to the SMN2 pre-mRNA complex. SMN-C2 can be used in spinal muscular atrophy (SMA) research .

HY-147217

Bepirovirsen ISIS 505358	HBV	Infection
Bepirovirsen is an antisense oligonucleotide targeting all HBV messenger RNAs. Bepirovirsen leads to reductions in HBV-derived RNAs, HBV DNA and viral proteins. Bepirovirsen can be used for the research of chronic HBV infection. Bepirovirsen binding site sequence (GCACTTCGCTTCACCTCTGC) .

HY-113761

ASN03576800	Filovirus	Infection
ASN03576800 could be a potent inhibitor for Ebola virus matrix protein VP40 in process of viral assembly and budding process. ASN03576800 occupies the RNA binding region of VP40 .

HY-176471

IGF2BP3-IN-1	Insulin Receptor	Cancer
IGF2BP3-IN-1 is an IGF2BP3 (a RNA binding protein) inhibitor (IC₅₀: > 50 μM), and can be used for cancer research .

HY-P5117

TAT-CIRP	Toll-like Receptor (TLR)	Neurological Disease
TAT-CIRP is a a small peptide, refers to Trans-trans-activating (Tat)-cold-inducible RNA binding protein. TAT-CIRP is an inhibitor of *myeloid differentiation protein* 2 (MD2**). TAT-CIRP exhibits robust neuroprotection against ischemic and hemorrhagic stroke in mice .

HY-124844

Azaphilone-9 AZA-9	HuR	Cancer
Azaphilone-9 (AZA-9) is an inhibitor of HuR-ARE RNA interaction (IC₅₀=1.2 μM) by binding RNA-binding protein Hu antigen R (HuR). The HuR-RNA interactions stabilize many oncogenic mRNAs in tumors. Thus Azaphilone-9 potentially inhibit cancer cell growth and progression .

HY-N14366

Fleephilone	HIV Endogenous Metabolite	Infection
Fleephilone is a fungal metabolite that can be isolated from Trichoderma harzianum. Fleephilone is a HIV REV/RRE binding inhibitor. Fleephilone inhibits the binding of REV-protein to RRE RNA with an IC₅₀ of 7.6 μM .

HY-101112

Okicenone	HuR	Inflammation/Immunology
Okicenone is a Hu protein R (HuR) inhibitor. Okicenone inhibits HuR oligomerization, interferes with HuR RNA binding, HuR trafficking, cytokine expression and T-cell activation .

HY-14855

Tedizolid Maximum Cited Publications 14 Publications Verification TR 700; Torezolid; DA-7157	Bacterial Antibiotic	Infection
Tedizolid (TR 700; Torezolid; DA-7157) is a novel oxazolidinone, acting through inhibition of bacterial protein synthesis by binding to 23S ribosomal RNA (rRNA) of the 50S subunit of the ribosome.

HY-147217A

Bepirovirsen sodium ISIS 505358 sodium	HBV	Infection
Bepirovirsen (ISIS 505358) sodium is an antisense oligonucleotide targeting all HBV messenger RNAs. Bepirovirsen sodium leads to reductions in HBV-derived RNAs, HBV DNA and viral proteins. Bepirovirsen sodium can be used for the research of chronic HBV infection. Bepirovirsen sodium binding site sequence (GCACTTCGCTTCACCTCTGC) .

HY-W240322

PSF-IN-1	Apoptosis	Cancer
PSF-IN-1 (Compound No.10-3) is a RNA-binding protein (PSF) inhibitor and can effectively inhibit the PSF-RNA interaction (IC₅₀: 2.2 pM). PSF-IN-1 can increase histone acetylation, inhibit tumor cell proliferation and induce apoptosis. PSF-IN-1 has antitumor activity .

HY-14855R

Tedizolid (Standard)	Bacterial Antibiotic	Infection
Tedizolid (Standard) is the analytical standard of Tedizolid. This product is intended for research and analytical applications. Tedizolid (TR 700; Torezolid; DA-7157) is a novel oxazolidinone, acting through inhibition of bacterial protein synthesis by binding to 23S ribosomal RNA (rRNA) of the 50S subunit of the ribosome.

HY-14855S

Tedizolid-13C,d3 TR 700-¹³C,d₃; Torezolid-¹³C,d₃; DA-7157-¹³C,d₃	Isotope-Labeled Compounds Bacterial Antibiotic	Infection
Tedizolid- ¹³C,d₃ is the ¹³C- and deuterium labeled Tedizolid. Tedizolid (TR 700; Torezolid; DA-7157) is a novel oxazolidinone, acting through inhibition of bacterial protein synthesis by binding to 23S ribosomal RNA (rRNA) of the 50S subunit of the ribosome.

HY-B0275

Oxytetracycline 5 Publications Verification	Bacterial HSV Endogenous Metabolite Antibiotic	Infection
Oxytetracycline is an antibiotic belonging to the tetracycline class. Oxytetracycline potent inhibits Gram-negative and Gram-positive bacteria. Oxytetracycline is a protein synthesis inhibitor and prevents the binding from aminoacil-tRNA to the complex m-ribosomal RNA. Oxytetracycline also possesses anti-HSV-1 activity .

HY-B0275A

Oxytetracycline hydrochloride 5 Publications Verification	Bacterial HSV Antibiotic Endogenous Metabolite	Infection
Oxytetracycline hydrochloride is an antibiotic belonging to the tetracycline class. Oxytetracycline hydrochloride potent inhibits Gram-negative and Gram-positive bacteria. Oxytetracycline hydrochloride is a protein synthesis inhibitor and prevents the binding from aminoacil-tRNA to the complex m-ribosomal RNA. Oxytetracycline hydrochloride also possesses anti-HSV-1 activity .

HY-153083

COVID-19 Spike Protein mRNA(N1-Me-Pseudo UTP)	SARS-CoV	Infection
COVID-19 Spike Protein mRNA will express COVID-19 spike protein, and suitable for detection of RNA delivery, translation efficiency, cell viability, etc. COVID-19 spike protein is the novel coronavirus pneumonia spike protein located on the membrane surface. COVID-19 spike protein undertakes the functions of virus binding to host cell membrane receptors and membrane fusion, thereby mediating the entry of COVID-19 virus into cells. COVID-19 spike protein is an important site of action for host neutralizing antibodies and a key target for vaccine design .

HY-B0220S

Erythromycin-d6	Bacterial Antibiotic	Infection
Erythromycin-d₆ is the deuterium labeled Erythromycin. Erythromycin is a macrolide antibiotic produced by actinomycete?Streptomyces erythreus?with a broad spectrum of antimicrobial activity. Erythromycin acts by binding to bacterial 50S ribosomal subunits and inhibits?RNA-dependent protein synthesis?by blockage of transpeptidation and/or translocation reactions, without affecting synthesis of nucleic acid .

HY-B0275C

Oxytetracycline calcium	Bacterial HSV Antibiotic Endogenous Metabolite	Infection
Oxytetracycline calcium is an antibiotic belonging to the tetracycline class. Oxytetracycline calcium potently inhibits Gram-negative and Gram-positive bacteria. Oxytetracycline calcium is a protein synthesis inhibitor and prevents the binding from aminoacil-tRNA to the complex m-ribosomal RNA. Oxytetracycline calcium also possesses anti-HSV-1 activity .

HY-B0275B

Oxytetracycline dihydrate 5 Publications Verification	Bacterial HSV Antibiotic Endogenous Metabolite	Infection
Oxytetracycline dihydrate is an antibiotic belonging to the tetracycline class. Oxytetracycline dihydrate potent inhibits Gram-negative and Gram-positive bacteria. Oxytetracycline dihydrate is a protein synthesis inhibitor and prevents the binding from aminoacil-tRNA to the complex m-ribosomal RNA. Oxytetracycline dihydrate also possesses anti-HSV-1 activity .

HY-B1099

Hycanthone 2 Publications Verification	DNA/RNA Synthesis Topoisomerase Parasite	Infection
Hycanthone is a thioxanthenone DNA intercalator and inhibits RNA synthesis as well as the DNA topoisomerases I and II. Hycanthone inhibits nucleic acid biosynthesis and inhibits apurinic endonuclease-1 (APE1) by direct protein binding with a K_D of 10 nM. Hycanthone is a bioactive metabolite of Lucanthone (HY-B2098) and has anti-schistosomal agent .

HY-153235

COVID-19 Spike Protein mRNA-LNP	SARS-CoV Liposome	Infection
COVID-19 Spike Protein mRNA-LNP is a lipid nanoparticle (LNP) containing mRNA encoding COVID-19 Spike Protein. COVID-19 Spike Protein undertakes the functions of virus binding with host cell receptors, thereby mediating the entry of COVID-19 virus into cells. COVID-19 Spike Protein is an important site of action for host neutralizing antibodies and a key target for vaccine design. COVID-19 Spike Protein mRNA-LNP can be used for RNA delivery, vaccine formulation and design targeting SARS-CoV-2 .

HY-124806

TTP-8307 1 Publications Verification	Enterovirus DNA/RNA Synthesis HCV	Infection
TTP-8307 is a potent inhibitor of the replication of several rhino- and enteroviruses. TTP-8307 inhibits coxsackievirus B3 (CVB3; EC₅₀=1.2 μM) and poliovirus by interfering with the synthesis of viral RNA. TTP-8307 exerts antiviral activity through oxysterol-binding protein (OSBP) .

HY-170523

RU-0415529	SARS-CoV DNA Methyltransferase	Infection
RU-0415529 is an orally active inhibitor for *SARS-CoV-2 nonstructural protein* 14 (NSP14) with an IC₅₀** of 356 nM. RU-0415529 binds to the SAH-stabilized cap binding pocket, inhibits viral RNA methylation and the viral replication. RU-0415529 exhibits anti-infectious activity in mouse models .

HY-162289

FAZ-3780 1 Publications Verification	DNA/RNA Synthesis	Cancer
FAZ-3780 (compound G3Ib) is an inhibitor of binding to the NTF2L domain of G3BP1/2 that binds to G3BP1 with a K_d of 0.15 μM. FAZ-3780 targets the protein-protein interaction domain of G3BP1/2 and specifically inhibits co-condensation of G3BP1, caprin 1, and RNA in vitro .

HY-124828

CMLD-2	HuR	Cancer
CMLD-2, an inhibitor of HuR-ARE interaction, competitively binds HuR protein disrupting its interaction with adenine-uridine rich elements (ARE)-containing mRNAs (K_i=350 nM). CMLD-2 induces apoptosis exhibits antitumor activity in different cancer cells as colon, pancreatic, thyroid and lung cancer cell lines. Hu antigen R (HuR) is an RNA binding protein, can regulate target mRNAs stability and translation .

HY-134601

KH-3	HuR	Cancer
KH-3 is a potent RNA-binding protein Hu antigen R (HuR) inhibitor with an IC₅₀ value of 0.35 μM. KH-3 has anti-proliferative activity. KH-3 suppresses breast cancer cell invasion as well as delays the initiation of lung colonies by disrupting HuR-FOXQ1 mRNA interaction .

HY-122903

TK216 5+ Cited Publications	DNA/RNA Synthesis	Cancer
TK216 is an orally active and potent E26 transformation specific (ETS) inhibitor . TK216 directly binds EWS-FLI1 and inhibits EWS-FLI1 protein interactions. TK216 blocks the binding between EWS-FLI1 and RNA helicase A. TK216 has anticancer activity .

HY-B0275S

Oxytetracycline-d6	Isotope-Labeled Compounds Antibiotic Bacterial Endogenous Metabolite HSV	Infection
Oxytetracycline-d₆ is deuterium labeled Oxytetracycline. Oxytetracycline is an antibiotic belonging to the tetracycline class. Oxytetracycline potent inhibits Gram-negative and Gram-positive bacteria. Oxytetracycline is a protein synthesis inhibitor and prevents the binding from aminoacil-tRNA to the complex m-ribosomal RNA. Oxytetracycline also possesses anti-HSV-1 activity .

HY-147918

Anticancer agent 73	DNA/RNA Synthesis	Cancer
Anticancer agent 73 (compound CIB-3b) is a anticancer agent, potently targeting *TAR RNA-binding* protein 2 (TRBP)** and disrupts its interaction with Dicer. Anticancer agent 73 can rebalance the expression profile of oncogenic or tumor-suppressive miRNAs. Anticancer agent 73 suppresses the proliferation and metastasis of HCC in vitro and in vivo .

HY-112591

NSC260594	Apoptosis HIV Wnt Bcl-2 Family	Cancer
NSC260594 induces Apoptosis. NSC260594 binds the shallow groove of the Mcl-1 protein, and inhibits Mcl-1 expression through down-regulation of Wnt signaling proteins. NSC260594 can also recognize G9-G10-A11-G12 RNA tetraloop of HIV and prevent the binding of the Gag protein within the 5’-UTR. NSC260594 inhibits tumor growth, and can be used for research of Triple-negative breast cancers (TNBCs) .

HY-B0275AR

Oxytetracycline (hydrochloride) (Standard)	Bacterial HSV Antibiotic Endogenous Metabolite	Infection
Oxytetracycline (hydrochloride) (Standard) is the analytical standard of Oxytetracycline (hydrochloride). This product is intended for research and analytical applications. Oxytetracycline hydrochloride is an antibiotic belonging to the tetracycline class. Oxytetracycline hydrochloride potent inhibits Gram-negative and Gram-positive bacteria. Oxytetracycline hydrochloride is a protein synthesis inhibitor and prevents the binding from aminoacil-tRNA to the complex m-ribosomal RNA. Oxytetracycline hydrochloride also possesses anti-HSV-1 activity .

HY-B0220S1

Erythromycin-13C,d3	Isotope-Labeled Compounds Bacterial Antibiotic	Infection
Erythromycin- ¹³C,d₃ is the ¹³C- and deuterium labeled Erythromycin. Erythromycin is a macrolide antibiotic produced by actinomycete?Streptomyces erythreus?with a broad spectrum of antimicrobial activity. Erythromycin acts by binding to bacterial 50S ribosomal subunits and inhibits?RNA-dependent protein synthesis?by blockage of transpeptidation and/or translocation reactions, without affecting synthesis of nucleic acid .

HY-B0275R

Oxytetracycline (Standard)	Bacterial HSV Endogenous Metabolite Antibiotic	Infection
Oxytetracycline (Standard) is the analytical standard of Oxytetracycline. This product is intended for research and analytical applications. Oxytetracycline is an antibiotic belonging to the tetracycline class. Oxytetracycline potent inhibits Gram-negative and Gram-positive bacteria. Oxytetracycline is a protein synthesis inhibitor and prevents the binding from aminoacil-tRNA to the complex m-ribosomal RNA. Oxytetracycline also possesses anti-HSV-1 activity .

HY-N14625

Harziphilone	Bacterial	Infection Cancer
Harziphilone has weak anti-Gram-positive bacterial activity and anti-tumor effect, it can inhibit lymphoblastic leukemia L1210 and leukemia P388 with IC₅₀ of 0.26 μg/mL. Harziphilone inhibits the binding of viral particle regulatory (REV) proteins to [ ³³P] labeled viral particle regulatory effector element (RRE) RNA, IC₅₀ is 2.0 μM .

HY-163759

HuR degrader 2	Molecular Glues HuR	Cancer
HuR degrader 2 (Compound 3) is a molecule glue, which targets RNA-binding protein Hu antigen R (HuR) and degrades 30% HuR at 0.1 μM. HuR degrader 2 inhibits the proliferation of cancer cell Colo-205, with IC₅₀≤200 nM. HuR degrader 2 exhibits a high affinity with cereblon, with an HTRF ratio < 0.02 .

HY-W755036

Oxytetracycline-13C,d3 hydrochloride	Isotope-Labeled Compounds Bacterial HSV Antibiotic	Infection
Oxytetracycline-13C,d3 hydrochloride is the 13C- and deuterium labeled Oxytetracycline hydrochloride (HY-B0275A). Oxytetracycline hydrochloride is an antibiotic that exhibits board-spectrum antibacterial activity. Oxytetracycline hydrochloride is a protein synthesis inhibitor and prevents the binding from aminoacil-tRNA to the complex m-ribosomal RNA. Oxytetracycline hydrochloride also possesses anti-HSV-1 activity .

HY-119030

Rubradirin	Antibiotic Bacterial	Infection
Rubradirin is a polypeptide synthesis inhibitor with significant antibacterial activity. It specifically targets the peptidyl site (P site) of the ribosome and interferes with the initiation of protein synthesis by preventing the binding of fMet-tRNA_f (formylmethionyl transfer RNA) to the 30S ribosomal subunit and the complete 70S ribosome in an initiation factor-dependent manner. Additionally, it dissociates already formed initiation complexes, thereby exerting its antibacterial effect .

HY-14507

YK-4-279 5+ Cited Publications	DNA/RNA Synthesis Apoptosis	Cancer
YK-4-279 blocks RNA Helicase A (RHA) binding with EWS-FLI1 (oncogenic protein). YK-4-279 induces apoptosis and shows anti-proliferation activities towards various cancer cells. YK-4-279 has a chiral center and it can be separated into two enantiomers. YK-4-279 can be used for the research of cancer .

HY-B0275BR

Oxytetracycline (dihydrate) (Standard)	Bacterial HSV Antibiotic Endogenous Metabolite	Infection
Oxytetracycline (dihydrate) (Standard) is the analytical standard of Oxytetracycline (dihydrate). This product is intended for research and analytical applications. Oxytetracycline dihydrate is an antibiotic belonging to the tetracycline class. Oxytetracycline dihydrate potent inhibits Gram-negative and Gram-positive bacteria. Oxytetracycline dihydrate is a protein synthesis inhibitor and prevents the binding from aminoacil-tRNA to the complex m-ribosomal RNA. Oxytetracycline dihydrate also possesses anti-HSV-1 activity .

HY-173274

CB039	Molecular Glues	Cancer
CB039 is a selective a molecular glue degrader that targets RBM39 (RNA-binding protein 39). CB039 promotes the formation of a ternary complex between RBM39 and the E3 ubiquitin ligase CUL4-DCAF15, leading to proteasomal degradation of RBM39. CB039 is promising for research of cancers with RBM39 dependency, such as acute myeloid leukemia (AML) and ovarian cancer .

HY-113225B

Guanosine triphosphate tritris GTP tritris	Endogenous Metabolite	Cancer
Guanosine triphosphate tritris (GTP tritris) serves as a vital enhancer of myogenic cell differentiation and plays a critical role in modulating miRNA-myogenic regulator factors. It also facilitates the release of exosomes enriched with guanosine and guanosine-derived molecules, and is regarded as an activated precursor for RNA synthesis. In mitochondrial function, GTP participates in the import of proteins into the matrix, which is essential for various regulated pathways, and is involved in initiating peptide synthesis through the binding of formylmethionyl-tRNA to the ribosome, as well as polypeptide chain elongation. Additionally, GTP acts as a phosphate and pyrophosphate carrier that channels chemical energy into specific biosynthetic pathways. It activates signal transducing G proteins that regulate cellular processes such as proliferation and differentiation, and its hydrolysis by small GTPases, including Ras and Rho, is integral to both proliferation and apoptosis. Furthermore, the small GTPase Rab is instrumental in vesicle docking, fusion, and formation. Beyond signal transduction, GTP is an energy-rich precursor in the enzymatic biosynthesis of DNA and RNA.

HY-B0268A

Enoxacin hydrate 1 Publications Verification Enoxacin sesquihydrate; AT-2266 hydrate; CI-919 hydrate	Bacterial DNA/RNA Synthesis MicroRNA Antibiotic	Infection Cancer
Enoxacin hydrate (Enoxacin sesquihydrate), a fluoroquinolone, interferes with DNA replication and inhibits bacterial DNA gyrase (IC₅₀=126 µg/ml) and topoisomerase IV (IC₅₀=26.5 µg/ml). Enoxacin hydrate is a miRNA processing activator and enhances siRNA-mediated mRNA degradation and promotes the biogenesis of endogenous miRNAs. Enoxacin hydrate has potent activities against gram-positive and -negative bacteria. Enoxacin hydrate is a cancer-specific growth inhibitor that acts by enhancing TAR RNA-binding protein 2 (TRBP)-mediated microRNA processing .

HY-B0268

Enoxacin 1 Publications Verification AT 2266; CI 919	Bacterial DNA/RNA Synthesis MicroRNA Antibiotic	Infection Cancer
Enoxacin (AT 2266), a fluoroquinolone, interferes with DNA replication and inhibits bacterial DNA gyrase (IC₅₀=126 µg/ml) and topoisomerase IV (IC₅₀=26.5 µg/ml). Enoxacin is a miRNA processing activator and enhances siRNA-mediated mRNA degradation and promotes the biogenesis of endogenous miRNAs. Enoxacin has potent activities against gram-positive and -negative bacteria. Enoxacin is a cancer-specific growth inhibitor that acts by enhancing TAR RNA-binding protein 2 (TRBP)-mediated microRNA processing .

HY-155237

LIN28-IN-1	MicroRNA	Cancer
LIN28-IN-1 (compound 5) is an inhibitor of the RNA-binding and regulatory protein LIN28 and binds to the LIN28 cold shock domain (CSD). LIN28-IN-1 effectively inhibits the interaction between LIN28 and let-7 miRNA (IC₅₀: 5.4 μM), blocking the negative impact of LIN28 on epigenetic gene regulation. LIN28-IN-1 significantly inhibits the proliferation of JAR cancer cells expressing LIN28 (IC₅₀: 6.4 μM) .

HY-B0268R

Enoxacin (Standard)	Bacterial DNA/RNA Synthesis MicroRNA Antibiotic	Infection Cancer
Enoxacin (Standard) is the analytical standard of Enoxacin. This product is intended for research and analytical applications. Enoxacin (AT 2266), a fluoroquinolone, interferes with DNA replication and inhibits bacterial DNA gyrase (IC50=126 μg/ml) and topoisomerase IV (IC50=26.5 μg/ml). Enoxacin is a miRNA processing activator and enhances siRNA-mediated mRNA degradation and promotes the biogenesis of endogenous miRNAs. Enoxacin has potent activities against gram-positive and -negative bacteria. Enoxacin is a cancer-specific growth inhibitor that acts by enhancing TAR RNA-binding protein 2 (TRBP)-mediated microRNA processing [4].

HY-B0268S2

Enoxacin-d8 hydrate	Isotope-Labeled Compounds Antibiotic MicroRNA DNA/RNA Synthesis Bacterial	Infection Cancer
Enoxacin-d₈ (hydrate) is deuterium labeled Enoxacin. Enoxacin (AT 2266), a fluoroquinolone, interferes with DNA replication and inhibits bacterial DNA gyrase (IC₅₀=126 μg/ml) and topoisomerase IV (IC₅₀=26.5 μg/ml). Enoxacin is a miRNA processing activator and enhances siRNA-mediated mRNA degradation and promotes the biogenesis of endogenous miRNAs. Enoxacin has potent activities against gram-positive and -negative bacteria. Enoxacin is a cancer-specific growth inhibitor that acts by enhancing TAR RNA-binding protein 2 (TRBP)-mediated microRNA processing .

HY-B0268S1

Enoxacin-d8 hydrochloride	Isotope-Labeled Compounds Bacterial DNA/RNA Synthesis MicroRNA Antibiotic	Infection Cancer
Enoxacin-d₈ (hydrochloride) is deuterium labeled Enoxacin. Enoxacin (AT 2266), a fluoroquinolone, interferes with DNA replication and inhibits bacterial DNA gyrase (IC₅₀=126 μg/ml) and topoisomerase IV (IC₅₀=26.5 μg/ml). Enoxacin is a miRNA processing activator and enhances siRNA-mediated mRNA degradation and promotes the biogenesis of endogenous miRNAs. Enoxacin has potent activities against gram-positive and -negative bacteria. Enoxacin is a cancer-specific growth inhibitor that acts by enhancing TAR RNA-binding protein 2 (TRBP)-mediated microRNA processing .

HY-B0268AR

Enoxacin (hydrate) (Standard)	Bacterial DNA/RNA Synthesis MicroRNA Antibiotic	Infection Cancer
Enoxacin (hydrate) (Standard) is the analytical standard of Enoxacin (hydrate). This product is intended for research and analytical applications. Enoxacin hydrate (Enoxacin sesquihydrate), a fluoroquinolone, interferes with DNA replication and inhibits bacterial DNA gyrase (IC50=126 μg/ml) and topoisomerase IV (IC50=26.5 μg/ml). Enoxacin hydrate is a miRNA processing activator and enhances siRNA-mediated mRNA degradation and promotes the biogenesis of endogenous miRNAs. Enoxacin hydrate has potent activities against gram-positive and -negative bacteria. Enoxacin hydrate is a cancer-specific growth inhibitor that acts by enhancing TAR RNA-binding protein 2 (TRBP)-mediated microRNA processing [4].

Cat. No.	Product Name

HY-L158

Highly Selective Inhibitors Library

5,344 compounds

According to reports, most known kinase inhibitors exert their effects through competitive binding in highly conserved ATP pockets. Although genetic techniques such as RNA interference can inactivate specific genes, most kinases are multi domain proteins, each of which has an independent function. Highly selective inhibitors have higher efficiency than non-selective inhibitors, and the selectivity to the target is at least 100 times higher. Therefore, ensuring the validation of targets with the most selective inhibitors is crucial for a more thorough understanding of the pharmacology of the kinase field. The Highly Selective Inhibitors Library contains 5,344 compounds, covering multiple targets and subtypes, such as GPCR protein family, Ion channel, multiple kinases, etc. The Highly Selective Inhibitors Library is an effective tool for screening different phenotypes

Cat. No.	Product Name	Type

HY-153235

COVID-19 Spike Protein mRNA-LNP

Drug Delivery

COVID-19 Spike Protein mRNA-LNP is a lipid nanoparticle (LNP) containing mRNA encoding COVID-19 Spike Protein. COVID-19 Spike Protein undertakes the functions of virus binding with host cell receptors, thereby mediating the entry of COVID-19 virus into cells. COVID-19 Spike Protein is an important site of action for host neutralizing antibodies and a key target for vaccine design. COVID-19 Spike Protein mRNA-LNP can be used for RNA delivery, vaccine formulation and design targeting SARS-CoV-2 .

Cat. No.	Product Name	Target	Research Area

HY-P5117

TAT-CIRP	Toll-like Receptor (TLR)	Neurological Disease
TAT-CIRP is a a small peptide, refers to Trans-trans-activating (Tat)-cold-inducible RNA binding protein. TAT-CIRP is an inhibitor of *myeloid differentiation protein* 2 (MD2**). TAT-CIRP exhibits robust neuroprotection against ischemic and hemorrhagic stroke in mice .

Cat. No.	Product Name	Category	Target	Chemical Structure

HY-B0275

Oxytetracycline 5 Publications Verification	Structural Classification Classification of Application Fields Source classification Antibacterial Disease Research Endogenous metabolite Other Antibiotics Plant agriculture research Infection Monophenols Microorganisms Antibiotics Resistance Selection Animal Husbandry Phenols Disease Research Fields	Bacterial HSV Endogenous Metabolite Antibiotic
Oxytetracycline is an antibiotic belonging to the tetracycline class. Oxytetracycline potent inhibits Gram-negative and Gram-positive bacteria. Oxytetracycline is a protein synthesis inhibitor and prevents the binding from aminoacil-tRNA to the complex m-ribosomal RNA. Oxytetracycline also possesses anti-HSV-1 activity .

HY-B0275A

Oxytetracycline hydrochloride 5 Publications Verification	Structural Classification Classification of Application Fields Source classification Antibacterial Disease Research Endogenous metabolite Other Antibiotics Infection Monophenols Microorganisms Antibiotics Phenols Disease Research Fields	Bacterial HSV Antibiotic Endogenous Metabolite
Oxytetracycline hydrochloride is an antibiotic belonging to the tetracycline class. Oxytetracycline hydrochloride potent inhibits Gram-negative and Gram-positive bacteria. Oxytetracycline hydrochloride is a protein synthesis inhibitor and prevents the binding from aminoacil-tRNA to the complex m-ribosomal RNA. Oxytetracycline hydrochloride also possesses anti-HSV-1 activity .

HY-B0275B

Oxytetracycline dihydrate 5 Publications Verification	Structural Classification Classification of Application Fields Source classification Antibacterial Disease Research Endogenous metabolite Other Antibiotics Infection Monophenols Microorganisms Antibiotics Phenols Disease Research Fields	Bacterial HSV Antibiotic Endogenous Metabolite
Oxytetracycline dihydrate is an antibiotic belonging to the tetracycline class. Oxytetracycline dihydrate potent inhibits Gram-negative and Gram-positive bacteria. Oxytetracycline dihydrate is a protein synthesis inhibitor and prevents the binding from aminoacil-tRNA to the complex m-ribosomal RNA. Oxytetracycline dihydrate also possesses anti-HSV-1 activity .

HY-B0275AR

Oxytetracycline (hydrochloride) (Standard)	Structural Classification Monophenols Microorganisms Antibiotics Source classification Phenols Antibacterial Disease Research Endogenous metabolite Other Antibiotics	Bacterial HSV Antibiotic Endogenous Metabolite
Oxytetracycline (hydrochloride) (Standard) is the analytical standard of Oxytetracycline (hydrochloride). This product is intended for research and analytical applications. Oxytetracycline hydrochloride is an antibiotic belonging to the tetracycline class. Oxytetracycline hydrochloride potent inhibits Gram-negative and Gram-positive bacteria. Oxytetracycline hydrochloride is a protein synthesis inhibitor and prevents the binding from aminoacil-tRNA to the complex m-ribosomal RNA. Oxytetracycline hydrochloride also possesses anti-HSV-1 activity .

HY-N14366

Fleephilone	Structural Classification Natural Products Microorganisms Source classification	HIV Endogenous Metabolite
Fleephilone is a fungal metabolite that can be isolated from Trichoderma harzianum. Fleephilone is a HIV REV/RRE binding inhibitor. Fleephilone inhibits the binding of REV-protein to RRE RNA with an IC₅₀ of 7.6 μM .

HY-101112

Okicenone	Structural Classification Microorganisms Source classification Phenols Polyphenols	HuR
Okicenone is a Hu protein R (HuR) inhibitor. Okicenone inhibits HuR oligomerization, interferes with HuR RNA binding, HuR trafficking, cytokine expression and T-cell activation .

HY-B0275C

Oxytetracycline calcium	Infection Quinones Structural Classification Classification of Application Fields Anthraquinones Source classification Endogenous metabolite Disease Research Fields	Bacterial HSV Antibiotic Endogenous Metabolite
Oxytetracycline calcium is an antibiotic belonging to the tetracycline class. Oxytetracycline calcium potently inhibits Gram-negative and Gram-positive bacteria. Oxytetracycline calcium is a protein synthesis inhibitor and prevents the binding from aminoacil-tRNA to the complex m-ribosomal RNA. Oxytetracycline calcium also possesses anti-HSV-1 activity .

HY-B0275R

Oxytetracycline (Standard)	Structural Classification Source classification Antibacterial Disease Research Endogenous metabolite Other Antibiotics Plant agriculture research Monophenols Microorganisms Antibiotics Resistance Selection Animal Husbandry Phenols	Bacterial HSV Endogenous Metabolite Antibiotic
Oxytetracycline (Standard) is the analytical standard of Oxytetracycline. This product is intended for research and analytical applications. Oxytetracycline is an antibiotic belonging to the tetracycline class. Oxytetracycline potent inhibits Gram-negative and Gram-positive bacteria. Oxytetracycline is a protein synthesis inhibitor and prevents the binding from aminoacil-tRNA to the complex m-ribosomal RNA. Oxytetracycline also possesses anti-HSV-1 activity .

HY-N14625

Harziphilone	Structural Classification Natural Products Microorganisms Source classification	Bacterial
Harziphilone has weak anti-Gram-positive bacterial activity and anti-tumor effect, it can inhibit lymphoblastic leukemia L1210 and leukemia P388 with IC₅₀ of 0.26 μg/mL. Harziphilone inhibits the binding of viral particle regulatory (REV) proteins to [ ³³P] labeled viral particle regulatory effector element (RRE) RNA, IC₅₀ is 2.0 μM .

HY-B0275BR

Oxytetracycline (dihydrate) (Standard)	Structural Classification Monophenols Microorganisms Antibiotics Source classification Phenols Antibacterial Disease Research Endogenous metabolite Other Antibiotics	Bacterial HSV Antibiotic Endogenous Metabolite
Oxytetracycline (dihydrate) (Standard) is the analytical standard of Oxytetracycline (dihydrate). This product is intended for research and analytical applications. Oxytetracycline dihydrate is an antibiotic belonging to the tetracycline class. Oxytetracycline dihydrate potent inhibits Gram-negative and Gram-positive bacteria. Oxytetracycline dihydrate is a protein synthesis inhibitor and prevents the binding from aminoacil-tRNA to the complex m-ribosomal RNA. Oxytetracycline dihydrate also possesses anti-HSV-1 activity .

Species:	Virus (18) Human (10) Mouse (1)
Tag:	His (19) SUMO (2) Tag Free (10) Strep (3) Myc (1) Flag (4)
Source:	HEK293 (1) P. pastoris (1) Sf9 insect cells (2) E. coli (26)

Cat. No.	Compare	Product Name	Species	Source

HY-P72145

	CIRBP Protein, Mouse (His) 1 Publications Verification Cirbp; CirpCold-inducible RNA-binding protein; A18 hnRNP; Glycine-rich RNA-binding protein CIRP	Mouse	E. coli
	CIRBP protein, a key player in cellular response to genotoxic stress, stabilizes survival-associated transcripts. It aids stress granule assembly, suppresses cell proliferation in the cold, and regulates translation. CIRBP interacts with EIF4G1, associates with ribosomes, and targets the 3'-UTRs of stress-responsive transcripts like RPA2 and TXN. It contributes to intricate molecular regulatory mechanisms. CIRBP Protein, Mouse (His) is the recombinant mouse-derived CIRBP protein, expressed by E. coli , with N-6*His labeled tag.

HY-P702824

	PNO1 Protein, Human (His) RNA-binding protein PNO1; Partner of NOB1	Human	E. coli
	PNO1 Protein, Human (His) is the recombinant human-derived PNO1, expressed by E. coli , with C-6*His labeled tag.

HY-P76261

	CIRBP Protein, Human (His) Cold-inducible RNA-binding protein A; XCIRP; cirbp-a; CIRP-1	Human	E. coli
	CIRBP is a cold-induced mRNA-binding protein that plays a key role in cellular responses to genotoxic stress, exerting a protective effect by stabilizing transcripts of genes critical for cell survival. As a translation activator, CIRBP appears to be critical for cold-induced inhibition of cell proliferation. CIRBP Protein, Human (His) is the recombinant human-derived CIRBP protein, expressed by E. coli , with N-His labeled tag.

HY-P71612

	RBM14 Protein, Human (His-SUMO) RBM14; SIP; RNA-binding protein 14; Paraspeckle protein 2; PSP2; RNA-binding motif protein 14; RRM-containing coactivator activator/modulator; Synaptotagmin-interacting protein; SYT-interacting protein	Human	E. coli
	The RBM14 protein has different isoforms with multiple functions. Isoform 1 enhances transcription as a nuclear receptor coactivator, interacting with NCOA6 and CITED1. RBM14 Protein, Human (His-SUMO) is the recombinant human-derived RBM14 protein, expressed by E. coli , with N-SUMO, N-6*His labeled tag.

HY-P702591

	PTBP1 Protein, Human (HEK293, His) Polypyrimidine tract-binding protein 1; PTB; 57 kDa RNA-binding protein PPTB-1; Heterogeneous nuclear ribonucleoprotein I (hnRNP I)	Human	HEK293
	PTBP1 Protein, Human (HEK293, His) is the recombinant human-derived PTBP1, expressed by HEK293 , with N-10*His labeled tag. ,

HY-P702630

	FUS Protein, Human (His, Myc) RNA-binding protein FUS; 75 kDa DNA-pairing protein; Oncogene FUS; Oncogene TLS; POMp75; Translocated in liposarcoma protein; TLS	Human	E. coli
	FUS Protein, Human (His, Myc) is the recombinant human-derived FUS, expressed by E. coli , with N-10*His, C-Myc labeled tag.

HY-P75559

	acnB Protein, E. coli Aconitate hydratase B; ACN; Aconitase; RNA-binding protein; acnB; yacI; yacJ	Virus	E. coli
	The acnB protein coordinates short-chain fatty acid catabolism through the TCA pathway and 2-methylcitric acid cycle I, demonstrating catalytic versatility. It is involved in the reversible isomerization of citric acid to isocitrate and the hydration of 2-methyl-cis-aconitic acid. acnB Protein, E. coli is the recombinant Virus-derived acnB protein, expressed by E. coli , with tag free.

HY-P703385

	MSI2 Protein, Human (His, Strep) RNA-binding protein Musashi homolog 2; MSI2; Homo sapiens; Human; Musashi-2; RNA-binding	Human	E. coli
	MSI2 Protein, Human (His, Strep) is the recombinant human-derived MSI2, expressed by E. coli , with Strep, His labeled tag. ,

HY-P71819

	ELAVL3 Protein, Human (P.pastoris, His) ELAV like 3; ELAV like 4; ELAV like neuron specific RNA binding protein 3; ELAV like neuron specific RNA binding protein 4; ELAV like protein 3; ELAV like protein 4; ELAV-like protein 3; PLE21; PNEM	Human	P. pastoris
	ELAVL3 protein is an RNA-binding protein that specifically binds to the ARE sequence in target mRNA, including VEGF. It may also interact with polyA tracts through its RRM3. ELAVL3 Protein, Human (P.pastoris, His) is the recombinant human-derived ELAVL3 protein, expressed by P. pastoris , with N-His labeled tag.

HY-P702000

	LRRFIP1 Protein, Human (FLAG) LRRFIP1; Leucine-rich repeat flightless-interacting protein 1; LRR FLII-interacting protein 1; GC-binding factor 2; TAR RNA-interacting protein	Human	E. coli
	LRRFIP1 is a transcriptional repressor that preferentially binds to GC-rich sequences (5'-AGCCCCCGGCG-3') and may regulate the expression of TNF, EGFR, and PDGFA. It inhibits PDGFA, which controls smooth muscle cell proliferation after arterial injury. LRRFIP1 Protein, Human (FLAG) is the recombinant human-derived LRRFIP1 protein, expressed by E. coli , with C-Flag labeled tag.

HY-P703547

	HCVNS5B Protein, HCV Genome polyprotein; Hepatitis C virus genotype 1b (strain HC-J4); HCV; p23; Helicase; Hydrolase; Ion channel; Multifunctional enzyme; Nucleotidyltransferase; Protease; Ribonucleoprotein; RNA-binding; RNA-directed RNA polymerase; Serine protease; Thiol protease; Transferase; Viral ion channel; Viral nucleoprotein	Others	E. coli
	POLG proteins play multiple roles in the viral life cycle, contributing to viral RNA packaging, budding, and particle production. It exhibits RNA-binding and RNA chaperone activities, affecting translation initiation through interactions with viral IRES and ribosomal subunits. HCVNS5B Protein, HCV is the recombinant HCVNS5B, expressed by E. coli , with tag Free labeled tag. ,

HY-P703528

	SARS-CoV-2 NCP N Protein (His) Nucleoprotein; Nucleocapsid protein; NC; protein N; N; Severe acute respiratory syndrome coronavirus 2; 2019-nCoV; N; Ribonucleoprotein; RNA-binding; Viral nucleoprotein	Virus	E. coli

HY-P702001

	LRRFIP1 Protein, Human (His, StrepⅡ, Flag) LRRFIP1; Leucine-rich repeat flightless-interacting protein 1; LRR FLII-interacting protein 1; GC-binding factor 2; TAR RNA-interacting protein	Human	E. coli
	LRRFIP1 is a transcriptional repressor that preferentially binds to GC-rich sequences (5'-AGCCCCCGGCG-3') and may regulate the expression of TNF, EGFR, and PDGFA. It inhibits PDGFA, which controls smooth muscle cell proliferation after arterial injury. LRRFIP1 Protein, Human (His, Strep) is the recombinant human-derived LRRFIP1 protein, expressed by E. coli , with N-Strep, N-6*His labeled tag.

HY-P703532

	SARS-CoV-2 NSP16-NSP10 Protein Replicase polyprotein 1ab; ORF1ab polyprotein; rep; Severe acute respiratory syndrome coronavirus 2; 2019-nCoV; pp1ab; Endonuclease; Exonuclease; Helicase; Hydrolase; Lyase; Methyltransferase; Nuclease Nucleotidyltransferase; Protease; RNA-binding; RNA-directed RNA polymerase; Thiol protease; Transferase;	Virus	E. coli

HY-P703533

	SARS-CoV-2 NSP16-NSP10 Protein (His) Replicase polyprotein 1ab; ORF1ab polyprotein; rep; Severe acute respiratory syndrome coronavirus 2; 2019-nCoV; pp1ab; Endonuclease; Exonuclease; Helicase; Hydrolase; Lyase; Methyltransferase; Nuclease Nucleotidyltransferase; Protease; RNA-binding; RNA-directed RNA polymerase; Thiol protease; Transferase;	Virus	E. coli

HY-P703543

	SARS-CoV-2 RdRP Protein (sf9, His, Strep) Replicase polyprotein 1ab; ORF1ab polyprotein; rep; Severe acute respiratory syndrome coronavirus 2; 2019-nCoV; pp1ab; Endonuclease; Exonuclease; Helicase; Hydrolase; Lyase; Methyltransferase; Nuclease Nucleotidyltransferase; Protease; RNA-binding; RNA-directed RNA polymerase; Thiol protease; Transferase;	Virus	Sf9 insect cells

HY-P703529

	SARS-CoV-2 NCP N Protein (101a.a) Nucleoprotein; Nucleocapsid protein; NC; protein N; N; Severe acute respiratory syndrome coronavirus 2; 2019-nCoV; N; Ribonucleoprotein; RNA-binding; Viral nucleoprotein	Virus	E. coli

HY-P703530

	SARS-CoV-2 NCP N Protein (126a.a) Nucleoprotein; Nucleocapsid protein; NC; protein N; N; Severe acute respiratory syndrome coronavirus 2; 2019-nCoV; N; Ribonucleoprotein; RNA-binding; Viral nucleoprotein	Virus	E. coli

HY-P703531

	SARS-CoV-2 NCP N Protein (sf9, His, Flag) Nucleoprotein; Nucleocapsid protein; NC; protein N; N; Severe acute respiratory syndrome coronavirus 2; 2019-nCoV; N; Ribonucleoprotein; RNA-binding; Viral nucleoprotein	Virus	Sf9 insect cells
	The SARS-CoV-2 nucleocapsid protein plays a crucial role in assembling the virion, forming the helical ribonucleocapsid (RNP), and interacting with the viral genome and membrane protein M. In addition to its structural function, it also enhances subgenomic viral RNA transcription and overall replication. NCP N Protein, SARS-CoV-2 (sf9, His, Flag) is the recombinant virus-derived NCP N, expressed by sf9 insect cells , with His, Flag labeled tag. ,

HY-P703548

	pp1a Protein, AIBV (His) Replicase polyprotein 1a; ORF1a polyprotein; Avian infectious bronchitis virus (strain M41); IBV; pp1a; Hydrolase; Lyase; Protease; RNA-binding; Thiol protease	Virus	E. coli

HY-P703540

	SARS-CoV-2 NSP8 Protein Replicase polyprotein 1a; ORF1a polyprotein; Severe acute respiratory syndrome coronavirus 2; 2019-nCoV; pp1a; Endonuclease; Hydrolase; Methyltransferase; Nuclease; Protease; RNA-binding; Thiol protease; Transferase	Virus	E. coli
	The multifunctional PL-PRO protein plays a critical role in viral RNA transcription and replication, providing the necessary proteases for multiprotein cleavage. It strategically blocks host translation by binding to the open head conformation of the 40S subunit, impeding ribosomal mRNA entry into the tunnel. NSP8 Protein, SARS-CoV-2 is the recombinant virus-derived NSP8, expressed by E. coli , with tag Free labeled tag. ,

HY-P703536

	SARS-CoV-2 NSP3 Protein (His) Replicase polyprotein 1a; ORF1a polyprotein; Severe acute respiratory syndrome coronavirus 2; 2019-nCoV; pp1a; Endonuclease; Hydrolase; Methyltransferase; Nuclease; Protease; RNA-binding; Thiol protease; Transferase	Virus	E. coli
	The multifunctional PL-PRO protein plays a critical role in viral RNA transcription and replication, providing the necessary proteases for multiprotein cleavage. It strategically blocks host translation by binding to the open head conformation of the 40S subunit, impeding ribosomal mRNA entry into the tunnel. NSP3 Protein, SARS-CoV-2 (His) is the recombinant virus-derived NSP3, expressed by E. coli , with His labeled tag. ,

HY-P703542

	SARS-CoV-2 NSP9 Protein (His) Replicase polyprotein 1a; ORF1a polyprotein; Severe acute respiratory syndrome coronavirus 2; 2019-nCoV; pp1a; Endonuclease; Hydrolase; Methyltransferase; Nuclease; Protease; RNA-binding; Thiol protease; Transferase	Virus	E. coli
	The multifunctional PL-PRO protein plays a critical role in viral RNA transcription and replication, providing the necessary proteases for multiprotein cleavage. It strategically blocks host translation by binding to the open head conformation of the 40S subunit, impeding ribosomal mRNA entry into the tunnel. NSP9 Protein, SARS-CoV-2 (His) is the recombinant virus-derived NSP9, expressed by E. coli , with His labeled tag. ,

HY-P703541

	SARS-CoV-2 NSP8 Protein (His, Flag) Replicase polyprotein 1a; ORF1a polyprotein; Severe acute respiratory syndrome coronavirus 2; 2019-nCoV; pp1a; Endonuclease; Hydrolase; Methyltransferase; Nuclease; Protease; RNA-binding; Thiol protease; Transferase	Virus	E. coli
	The multifunctional PL-PRO protein plays a critical role in viral RNA transcription and replication, providing the necessary proteases for multiprotein cleavage. It strategically blocks host translation by binding to the open head conformation of the 40S subunit, impeding ribosomal mRNA entry into the tunnel. NSP8 Protein, SARS-CoV-2 (His, Flag) is the recombinant virus-derived NSP8, expressed by E. coli , with His, Flag labeled tag. ,

HY-P703534

	SARS-CoV-2 NSP3 Protein (372a.a) Replicase polyprotein 1a; ORF1a polyprotein; Severe acute respiratory syndrome coronavirus 2; 2019-nCoV; pp1a; Endonuclease; Hydrolase; Methyltransferase; Nuclease; Protease; RNA-binding; Thiol protease; Transferase	Virus	E. coli

HY-P703535

	SARS-CoV-2 NSP3 Protein (183a.a) Replicase polyprotein 1a; ORF1a polyprotein; Severe acute respiratory syndrome coronavirus 2; 2019-nCoV; pp1a; Endonuclease; Hydrolase; Methyltransferase; Nuclease; Protease; RNA-binding; Thiol protease; Transferase	Virus	E. coli

HY-P703537

	SARS-CoV-2 NSP3 Protein (357a.a) Replicase polyprotein 1a; ORF1a polyprotein; Severe acute respiratory syndrome coronavirus 2; 2019-nCoV; pp1a; Endonuclease; Hydrolase; Methyltransferase; Nuclease; Protease; RNA-binding; Thiol protease; Transferase	Virus	E. coli

HY-P703538

	SARS-CoV-2 NSP3 Protein (338a.a) Replicase polyprotein 1a; ORF1a polyprotein; Severe acute respiratory syndrome coronavirus 2; 2019-nCoV; pp1a; Endonuclease; Hydrolase; Methyltransferase; Nuclease; Protease; RNA-binding; Thiol protease; Transferase	Virus	E. coli

HY-P703539

	SARS-CoV-2 NSP7 Protein (83a.a, His) Replicase polyprotein 1a; ORF1a polyprotein; Severe acute respiratory syndrome coronavirus 2; 2019-nCoV; pp1a; Endonuclease; Hydrolase; Methyltransferase; Nuclease; Protease; RNA-binding; Thiol protease; Transferase	Virus	E. coli

HY-P700506

	EIF3G Protein, Human (His-SUMO) eukaryotic translation initiation factor 3 subunit G; EIF3S4; EIF3-P42; eIF3-p44; eIF3-delta; eukaryotic translation initiation factor 3 subunit G; eukaryotic translation initiation factor 3 RNA-binding subunit; eukaryotic translation initiation factor 3 subunit p42; eukaryotic translation initiation factor 3, subunit 4 delta, 44kDa	Human	E. coli
	The EIF3G protein is an RNA-binding component of the eIF-3 complex that initiates protein synthesis by promoting the recruitment of factors to form the 43S PIC. EIF3G is critical in both mRNA recruitment and AUG recognition scanning. EIF3G Protein, Human (His-SUMO) is the recombinant human-derived EIF3G protein, expressed by E. coli , with N-SUMO, N-6*His labeled tag.

Compare Products


Products	In-stock - + Add to Cart
Cat. No.
Species
Source
Tag
Accession
Gene ID
Molecular Weight
Purity
Endotoxin Level
Biological Activity
Appearance
Formulation
Storage & Stability
Shipping
Free Sample	Yes No
Size	* This product has been "discontinued". Optimized version of product available: / In-stock - + Add to Cart Get quote

Cat. No.	Product Name	Chemical Structure

HY-B0220S

Erythromycin-d6

Erythromycin-d₆ is the deuterium labeled Erythromycin. Erythromycin is a macrolide antibiotic produced by actinomycete?Streptomyces erythreus?with a broad spectrum of antimicrobial activity. Erythromycin acts by binding to bacterial 50S ribosomal subunits and inhibits?RNA-dependent protein synthesis?by blockage of transpeptidation and/or translocation reactions, without affecting synthesis of nucleic acid .

HY-B0220S1

Erythromycin-13C,d3

Erythromycin- ¹³C,d₃ is the ¹³C- and deuterium labeled Erythromycin. Erythromycin is a macrolide antibiotic produced by actinomycete?Streptomyces erythreus?with a broad spectrum of antimicrobial activity. Erythromycin acts by binding to bacterial 50S ribosomal subunits and inhibits?RNA-dependent protein synthesis?by blockage of transpeptidation and/or translocation reactions, without affecting synthesis of nucleic acid .

HY-B0268S1

Enoxacin-d8 hydrochloride

Enoxacin-d₈ (hydrochloride) is deuterium labeled Enoxacin. Enoxacin (AT 2266), a fluoroquinolone, interferes with DNA replication and inhibits bacterial DNA gyrase (IC₅₀=126 μg/ml) and topoisomerase IV (IC₅₀=26.5 μg/ml). Enoxacin is a miRNA processing activator and enhances siRNA-mediated mRNA degradation and promotes the biogenesis of endogenous miRNAs. Enoxacin has potent activities against gram-positive and -negative bacteria. Enoxacin is a cancer-specific growth inhibitor that acts by enhancing TAR RNA-binding protein 2 (TRBP)-mediated microRNA processing .

HY-14855S

Tedizolid-13C,d3
Tedizolid- ¹³C,d₃ is the ¹³C- and deuterium labeled Tedizolid. Tedizolid (TR 700; Torezolid; DA-7157) is a novel oxazolidinone, acting through inhibition of bacterial protein synthesis by binding to 23S ribosomal RNA (rRNA) of the 50S subunit of the ribosome.

HY-B0275S

Oxytetracycline-d6
Oxytetracycline-d₆ is deuterium labeled Oxytetracycline. Oxytetracycline is an antibiotic belonging to the tetracycline class. Oxytetracycline potent inhibits Gram-negative and Gram-positive bacteria. Oxytetracycline is a protein synthesis inhibitor and prevents the binding from aminoacil-tRNA to the complex m-ribosomal RNA. Oxytetracycline also possesses anti-HSV-1 activity .

HY-W755036

Oxytetracycline-13C,d3 hydrochloride

Oxytetracycline-13C,d3 hydrochloride is the 13C- and deuterium labeled Oxytetracycline hydrochloride (HY-B0275A). Oxytetracycline hydrochloride is an antibiotic that exhibits board-spectrum antibacterial activity. Oxytetracycline hydrochloride is a protein synthesis inhibitor and prevents the binding from aminoacil-tRNA to the complex m-ribosomal RNA. Oxytetracycline hydrochloride also possesses anti-HSV-1 activity .

HY-B0268S2

Enoxacin-d8 hydrate

Enoxacin-d₈ (hydrate) is deuterium labeled Enoxacin. Enoxacin (AT 2266), a fluoroquinolone, interferes with DNA replication and inhibits bacterial DNA gyrase (IC₅₀=126 μg/ml) and topoisomerase IV (IC₅₀=26.5 μg/ml). Enoxacin is a miRNA processing activator and enhances siRNA-mediated mRNA degradation and promotes the biogenesis of endogenous miRNAs. Enoxacin has potent activities against gram-positive and -negative bacteria. Enoxacin is a cancer-specific growth inhibitor that acts by enhancing TAR RNA-binding protein 2 (TRBP)-mediated microRNA processing .

Cat. No.	Compare	Product Name	Application	Reactivity

HY-P82093

	hnRNP Q Antibody (YA1838) SYNCRIP; HNRPQ; NSAP1; Heterogeneous nuclear ribonucleoprotein Q; hnRNP Q; Glycine- and tyrosine-rich RNA-binding protein; GRY-RBP; NS1-associated protein 1; Synaptotagmin-binding; cytoplasmic RNA-interacting protein	WB, IHC-P, ICC/IF	Human, Mouse, Rat
	hnRNP Q Antibody (YA1838) is a rabbit-derived non-conjugated IgG antibody (Clone NO.: YA1838), targeting hnRNP Q, with a predicted molecular weight of 70 kDa (observed band size: 65-82 kDa). hnRNP Q Antibody (YA1838) can be used for WB, IHC-P, ICC/IF experiment in human, mouse, rat background.

HY-P82472

	PIAS1 Antibody (YA2217) PIAS1; DDXBP1; E3 SUMO-protein ligase PIAS1; DEAD/H box-binding protein 1; Gu-binding protein; GBP; protein inhibitor of activated STAT protein 1; RNA helicase II-binding protein	WB, IHC-P, ICC/IF, FC	Human, Mouse, Rat
	PIAS1 Antibody (YA2217) is a rabbit-derived non-conjugated IgG antibody (Clone NO.: YA2217), targeting PIAS1, with a predicted molecular weight of 72 kDa (observed band size: 76 kDa). PIAS1 Antibody (YA2217) can be used for WB, IHC-P, ICC/IF, FC experiment in human, mouse, rat background.

HY-P82389

	TAF15 Antibody (YA2134) TAF15; RBP56; TAF2N; TATA-binding protein-associated factor 2N; 68 kDa TATA-binding protein-associated factor; TAF(II)68; TAFII68; RNA-binding protein 56	WB, IHC-F, IHC-P, ICC/IF	Human, Mouse, Rat
	TAF15 Antibody (YA2134) is a rabbit-derived non-conjugated IgG antibody (Clone NO.: YA2134), targeting TAF15, with a predicted molecular weight of 62 kDa (observed band size: 77 kDa). TAF15 Antibody (YA2134) can be used for WB, IHC-F, IHC-P, ICC/IF experiment in human, mouse, rat background.

HY-P82525

	EWSR1 Antibody (YA2270) EWSR1; EWS; RNA-binding protein EWS; EWS oncogene; Ewing sarcoma breakpoint region 1 protein	WB, IHC-P, ICC/IF	Human, Mouse, Rat
	EWSR1 Antibody (YA2270) is a rabbit-derived non-conjugated IgG antibody (Clone NO.: YA2270), targeting EWSR1, with a predicted molecular weight of 68 kDa (observed band size: 85 kDa). EWSR1 Antibody (YA2270) can be used for WB, IHC-P, ICC/IF experiment in human, mouse, rat background.

HY-P83284

	hnRNP G Antibody (YA3029) RBMX; HNRPG; RBMXP1; RNA-binding motif protein; X chromosome; Glycoprotein p43; Heterogeneous nuclear ribonucleoprotein G; hnRNP G	WB, IHC-F, IHC-P, ICC/IF	Human
	hnRNP G Antibody (YA3029) is a rabbit-derived non-conjugated IgG antibody (Clone NO.: YA3029), targeting hnRNP G, with a predicted molecular weight of 42 kDa (observed band size: 42 kDa). hnRNP G Antibody (YA3029) can be used for WB, IHC-F, IHC-P, ICC/IF experiment in human background.

HY-P83070

	Musashi 1 Antibody (YA2815) RNA-binding protein Musashi homolog 1; Musashi-1; MSI1	WB, IHC-P, ICC/IF, IP, FC	Human
	Musashi 1 Antibody (YA2815) is a rabbit-derived non-conjugated IgG antibody (Clone NO.: YA2815), targeting Musashi 1, with a predicted molecular weight of 39 kDa (observed band size: 39 kDa). Musashi 1 Antibody (YA2815) can be used for WB, IHC-P, ICC/IF, IP, FC experiment in human background.

HY-P83300

	Musashi 2 Antibody (YA3045) MSI2; RNA-binding protein Musashi homolog 2; Musashi-2	WB, IHC-P, ICC/IF, FC	Human, Mouse, Rat
	Musashi 2 Antibody (YA3045) is a rabbit-derived non-conjugated IgG antibody (Clone NO.: YA3045), targeting Musashi 2, with a predicted molecular weight of 35 kDa (observed band size: 35 kDa). Musashi 2 Antibody (YA3045) can be used for WB, IHC-P, ICC/IF, FC experiment in human, mouse, rat background.

HY-P83061

	CUG BP1 Antibody (YA2806) CELF1; BRUNOL2; CUGBP; CUGBP1; NAB50; CUGBP Elav-like family member 1; CELF-1; 50 kDa nuclear polyadenylated RNA-binding protein; Bruno-like protein 2; CUG triplet repeat RNA-binding protein 1; CUG-BP1; CUG-BP- and ETR-3-like factor 1; Dead	WB, IHC-P, ICC/IF, IP, FC	Human, Mouse, Rat
	CUG BP1 Antibody (YA2806) is a rabbit-derived non-conjugated IgG antibody (Clone NO.: YA2806), targeting CUG BP1, with a predicted molecular weight of 52 kDa (observed band size: 52 kDa). CUG BP1 Antibody (YA2806) can be used for WB, IHC-P, ICC/IF, IP, FC experiment in human, mouse, rat background.

HY-P83592

	DAZL Antibody (YA3337) DAZ homolog; DAZ like autosomal; DAZH; DAZL; DAZL1; DAZLA; Deleted in azoospermia like 1; Germline specific RNA binding protein; SPGY like autosomal; SPGYLA; Tpx2	WB	Human
	DAZL Antibody (YA3337) is a non-conjugated IgG antibody, targeting DAZL, with a predicted molecular weight of 33 kDa (observed band size: 33 kDa). DAZL Antibody (YA3337) can be used for WB experiment in human background.

HY-P82159

	ILF3 Antibody (YA1904) ILF3; DRBF; MPHOSPH4; NF90; Interleukin enhancer-binding factor 3; Double-stranded RNA-binding protein 76; DRBP76; M-phase phosphoprotein 4; MPP4; Nuclear factor associated with dsRNA; NFAR; Nuclear factor of activated T-cells 90 kDa; NF-AT-90; Translational control protein 80; TCP80	WB, IHC-P, ICC/IF, IP, FC	Human, Mouse
	ILF3 Antibody (YA1904) is a rabbit-derived non-conjugated IgG antibody (Clone NO.: YA1904), targeting ILF3, with a predicted molecular weight of 95 kDa (observed band size: 95 kDa). ILF3 Antibody (YA1904) can be used for WB, IHC-P, ICC/IF, IP, FC experiment in human, mouse background.

Compare Products


Products	In-stock - + Add to Cart
Cat. No.
Host
Reactivity
Application
Dilution Ratio
Molecular Weight
Conjugation
Clonality
Immunogen
Appearance
Isotype
Gene ID
SwissProt ID
Purity
Formulation
Free Sample	Yes No
Size	* This product has been "discontinued". Optimized version of product available: / In-stock - + Add to Cart Get quote

Cat. No.	Product Name		Classification

HY-147217

Bepirovirsen ISIS 505358		Antisense Oligonucleotides
Bepirovirsen is an antisense oligonucleotide targeting all HBV messenger RNAs. Bepirovirsen leads to reductions in HBV-derived RNAs, HBV DNA and viral proteins. Bepirovirsen can be used for the research of chronic HBV infection. Bepirovirsen binding site sequence (GCACTTCGCTTCACCTCTGC) .

HY-147217A

Bepirovirsen sodium ISIS 505358 sodium		Antisense Oligonucleotides
Bepirovirsen (ISIS 505358) sodium is an antisense oligonucleotide targeting all HBV messenger RNAs. Bepirovirsen sodium leads to reductions in HBV-derived RNAs, HBV DNA and viral proteins. Bepirovirsen sodium can be used for the research of chronic HBV infection. Bepirovirsen sodium binding site sequence (GCACTTCGCTTCACCTCTGC) .

HY-153083

COVID-19 Spike Protein mRNA(N1-Me-Pseudo UTP)		mRNA
COVID-19 Spike Protein mRNA will express COVID-19 spike protein, and suitable for detection of RNA delivery, translation efficiency, cell viability, etc. COVID-19 spike protein is the novel coronavirus pneumonia spike protein located on the membrane surface. COVID-19 spike protein undertakes the functions of virus binding to host cell membrane receptors and membrane fusion, thereby mediating the entry of COVID-19 virus into cells. COVID-19 spike protein is an important site of action for host neutralizing antibodies and a key target for vaccine design .

HY-153235

COVID-19 Spike Protein mRNA-LNP		mRNA
COVID-19 Spike Protein mRNA-LNP is a lipid nanoparticle (LNP) containing mRNA encoding COVID-19 Spike Protein. COVID-19 Spike Protein undertakes the functions of virus binding with host cell receptors, thereby mediating the entry of COVID-19 virus into cells. COVID-19 Spike Protein is an important site of action for host neutralizing antibodies and a key target for vaccine design. COVID-19 Spike Protein mRNA-LNP can be used for RNA delivery, vaccine formulation and design targeting SARS-CoV-2 .

HY-153845

RNA Aptamer Broccoli sodium		Aptamers
RNA Aptamer Broccoli (sodium) is a 49-nt-long aptamer that is substantially shorter than Spinach and Spinach2 and exhibits bright green fluorescence upon binding DFHBI or DFHBI-1T (soluble analogs of the fluorophore of green fluorescent protein). RNA Aptamer Broccoli (sodium) can be used to visualize RNA expression or localization in live cells. In vitro Broccoli exhibits a similar high folding efficiency as Spinach2, but exhibits markedly lower dependence on magnesium for folding and increased thermostability. Additionally, unlike Spinach2, Broccoli does not require the use of a tRNA scaffold to promote its folding in vivo.

HY-153843

RNA Aptamer Corn sodium		Aptamers
RNA Aptamer Corn (sodium) is a 28-nt-long aptamer that is substantially shorter than Spinach and Spinach2 and exhibits bright red fluorescence upon binding DFHO (a soluble analog of the intrinsic fluorophore of red fluorescent protein), RNA Aptamer Corn (sodium) can be used to visualize RNA expression or localization in live cells which have been soaked with chromophores. The Corn-DFHO does not become appreciably cytotoxic when illuminated. And most importantly, Corn-DFHO exhibits markedly increased photostability compared to other aptamer-chromophore complexes both in vitro and in vivo. (36 nt Corn construct: 5'-GGCGCGAGGAAGGAGGUCUGAGGAGGUCACUGCGCC-3'; A 36-nt RNA construct, comprised of the 28-nt minimal Corn sequence extended proximally with a 4 base-pair stem.)

Inquiry Online

Your information is safe with us. * Required Fields.

MCE Japan Authorized Agent ナミキ商事株式会社コスモ・バイオ株式会社
Salutation			Country or Region *
Applicant Name *			Organization Name *
Department *
Email Address *			Product Name *
Cat. No.			Requested quantity *
Phone Number *
Remarks

Inquiry Online

Inquiry Information

Product Name:
Cat. No.:
Quantity:
MCE Japan Authorized Agent:

RNA binding protein

Inhibitors & Agonists

Screening Libraries

Biochemical Assay Reagents

Peptides

NaturalProducts

Recombinant Proteins

Isotope-Labeled Compounds

Antibodies

Oligonucleotides

Natural
Products