Search Result

Results for "

protein sequence

" in MedChemExpress (MCE) Product Catalog:

By Targets:	15-PGDH (1) AAK1 (1) Akt (1) Amino Acid Derivatives (1) Amylin Receptor (1) Amyloid-β (3) Antibiotic (1) Apoptosis (6) Autophagy (2) Bacterial (3) Bcl-2 Family (2) Biochemical Assay Reagents (4) c-Myc (2) Caspase (2) CDK (1) Complement System (1) Cyclin G-associated Kinase (GAK) (1) DNA Alkylator/Crosslinker (1) DNA/RNA Synthesis (3) Drug Intermediate (1) DYRK (1) EBV (1) Endogenous Metabolite (1) Endonuclease (1) Eukaryotic Initiation Factor (eIF) (1) Fluorescent Dye (2) Fungal (1) GABA Receptor (1) Glycosidase (1) HBV (2) HIV (1) Influenza Virus (1) Integrin (1) LIM Kinase (LIMK) (1) Lipocalin Family (1) MARCKS (5) MDM-2/p53 (4) MyD88 (2) Notch (1) Parasite (1) PD-1/PD-L1 (2) Peptide-Drug Conjugates (PDCs) (1) PKC (7) PROTACs (1) Protease Activated Receptor (PAR) (1) PSMA (1) Reference Standards (2) Reverse Transcriptase (1) Salt-inducible Kinase (SIK) (1) SARS-CoV (1) Ser/Thr Kinase (1) Ser/Thr Protease (1) TGF-β Receptor (1) Thrombin (6) Transmembrane Glycoprotein (1) TRP Channel (1) VEGFR (2) Virus Protease (1) Wee1 (1)
By Research Areas:	Cancer (26) Cardiovascular Disease (8) Infection (9) Inflammation/Immunology (11) Neurological Disease (15)
Oligonucleotides:	Nucleosides and their Analogs (1) G (1) Aptamers (1) Antisense Oligonucleotides (2)

Inhibitors & Agonists

Screening Libraries

Fluorescent Dye

Biochemical Assay Reagents

Peptides

Inhibitory Antibodies

Natural
Products

Recombinant Proteins

Antibodies

Oligonucleotides

Cat. No.	Product Name	Target	Research Areas	Chemical Structure

HY-130533

ReAsH-EDT2	Fluorescent Dye	Others
ReAsH-EDT2 is a red fluorescent dye that marks proteins. ReAsH-EDT2 is a membrane-permeable biarsenical compound that binds covalently to tetracysteine sequences which allows the protein to be imaged. ReAsH-EDT2 can be used for protein localization and trafficking. (λ_ex=530 nm, λ_em=592 nm) .

HY-P0315

Crosstide 2 Publications Verification	Akt	Others
Crosstide is a peptide analog of glycogen synthase kinase α/β fusion protein sequence which is a substrate for Akt.

HY-P4808A

PHF6 TFA	Amyloid-β Autophagy	Neurological Disease
PHF6 (VQIVYK) TFA is a self-assembly sequence capable of initiating the full-length tau protein aggregation. PHF6 TFA is mapped to the third microtubule-binding repeat region of the tau protein .

HY-P1849A

JAG-1, scrambled TFA scJag-1 TFA	Notch	Cardiovascular Disease
JAG-1, scrambled (scJag-1) TFA is a scrambled sequence of JAG-1 (Jagged-1 protein). JAG-1, scrambled TFA has a random sequence of the amino acids that are the same as the active fragment. JAG-1, scrambled TFA is usually used as a negative control .

HY-P3732

RGD-4C	Integrin	Cancer
RGD-4C is a arginine-glycine-aspartic acid peptide (ACDCRGDCFC) with integrin binding activity. The Arg-Gly-Asp (RGD) sequence serves as the primary integrin recognition site in extracellular matrix proteins, and peptides containing this sequence can mimic the recognition specificity of the matrix proteins. RGD-4C is a αv-integrin ligand, can conjugate with bioactive molecule to exert antitumor effects in animal models .

HY-P5430

DYRKtide	DYRK	Others
DYRKtide is a biological active peptide. (Dyrktide is designed as the optimal substrate sequence efficiently phosphorylated by DYRK1A, which is a dual-specificity protein kinase that is thought to be involved in brain development.)

HY-P3935

Arg-Gly-Tyr-Ser-Leu-Gly	Ser/Thr Kinase	Cancer
Arg-Gly-Tyr-Ser-Leu-Gly is corresponding to the sequence of residues from 21 through 26 in lysozyme. Arg-Gly-Tyr-Ser-Leu-Gly can be used as a substrate for the protein kinase, and phosphorylated at serine residue by protein kinase .

HY-157881

2-Mercaptoethanesulfonic acid (ampule,3.0M±0.1M in H2O) β-Mercaptoethanesulfonic acid (ampule,3.0M±0.1M in H2O)	Biochemical Assay Reagents	Others
2-Mercaptoethanesulfonic acid (ampule,3.0M±0.1M in H2O) is a biochemical reagent that can be used for protein sequence analysis .

HY-P1734

Ac-MBP (1-11)	PKC	Neurological Disease
Ac-MBP 1-11, a short peptide sequence, is the major encephalitogenic epitope in myelin basic protein (MBP) .

HY-P4808

PHF6	Amyloid-β Autophagy	Neurological Disease
PHF6 (VQIVYK) is a self-assembly sequence capable of initiating the full-length tau protein aggregation and is mapped to the third microtubule-binding repeat region of the tau protein .

HY-P10719

Pepinh-MYD	MyD88	Infection Inflammation/Immunology
Pepinh-MYD is a MyD88 inhibitor that contains a domain sequence from MyD88 TIR and a protein transduction sequence, enabling it to penetrate the cell membrane. Pepinh-MYD interferes with MyD88-mediated TLR signaling pathways, thereby inhibiting related immune responses. It holds potential for studying the role of MyD88 in viral infections .

HY-114164D

Rat Thrombin	Thrombin	Cardiovascular Disease
Rat Thrombin is a Na ⁺-activated, allosteric serine protease that plays opposing functional roles in blood coagulation. Thrombin recognition sequence and can be used to digest GST-tagged proteins .

HY-114164F

Canine Thrombin	Thrombin	Cardiovascular Disease
Canine Thrombin is a Na ⁺-activated, allosteric serine protease that plays opposing functional roles in blood coagulation. Thrombin recognition sequence and can be used to digest GST-tagged proteins .

HY-114164E

Rabbit Thrombin	Thrombin	Cardiovascular Disease
Rabbit Thrombin is a Na ⁺-activated, allosteric serine protease that plays opposing functional roles in blood coagulation. Thrombin recognition sequence and can be used to digest GST-tagged proteins .

HY-114164C

Thrombin, Pig blood	Protease Activated Receptor (PAR) Thrombin	Cardiovascular Disease
Rabbit Thrombin is a Na ⁺-activated, allosteric serine protease that plays opposing functional roles in blood coagulation. Thrombin recognition sequence and can be used to digest GST-tagged proteins .

HY-114164G

Murine Thrombin	Thrombin	Cardiovascular Disease
Murine Thrombin is a Na ⁺-activated, allosteric serine protease that plays opposing functional roles in blood coagulation. Thrombin recognition sequence and can be used to digest GST-tagged proteins .

HY-114164

Thrombin (MW 37kDa) 5+ Cited Publications	Thrombin	Neurological Disease
Thrombin (MW 37kDa) is a Na ⁺-activated, allosteric serine protease that plays opposing functional roles in blood coagulation. Thrombin recognition sequence and can be used to digest GST-tagged proteins.

HY-P10719A

Pepinh-MYD TFA	MyD88	Infection Inflammation/Immunology
Pepinh-MYD TFA is a MyD88 inhibitor that contains a domain sequence from MyD88 TIR and a protein transduction sequence, enabling it to penetrate the cell membrane. Pepinh-MYD TFA interferes with MyD88-mediated TLR signaling pathways, thereby inhibiting related immune responses. Pepinh-MYD TFA holds potential for studying the role of MyD88 in viral infections .

HY-E70567

GlyCOUPER protease	Ser/Thr Protease	Others
GlyCOUPER protease can be used to digest flexible linkers of fusion proteins composed of glycine or glycine and serine residues, repeating sequences, such as (Gly4Ser)n, GlyxSery (GS), and poly-glycine (G) linkers.

HY-P2929B

PNGase F (Immobilized, Microspin)	Glycosidase	Cancer
PNGase F (Immobilized, Microspin) is a resin in which the PNGase F (peptide N-glycosidase F) enzyme is covalently coupled to agarose beads for the removal of N-glycans from antibodies, fusion proteins, and other N-glycosylated proteins. The enzyme is recombinantly expressed in E.coli and the sequence is derived from Flavobacterium meningsepticum .

HY-P10510

R5 peptide	Biochemical Assay Reagents	Others
R5 peptide is one of the repeating peptide sequences that form the protein diatom in Cylindrotheca fusiformis. R5 peptide can be used as a template for the synthesis of Pd (palladium) nanoparticles (NPs). R5 peptide forms complexes with metal ions through the amine groups in its sequence, and the self-assembled structure of the peptide provides a confined spatial environment for the reduction of metal ions and the nucleation of nanoparticles. R5 peptide can be used in the research of biomimetic nanomaterials .

HY-P10532

Myelin basic protein, MBP (68-86)	PKC	Others Inflammation/Immunology
Myelin basic protein, MBP (68-86) is the portion of the 68th to 86th amino acid residues in the MBP protein sequence. Myelin basic protein, MBP (68-86) can act as an autoantigen, triggering the immune system to attack its own myelin. Myelin basic protein, MBP (68-86) is used as one of the immunogens in the experimental autoimmune encephalomyelitis (EAE) animal model to study immune responses associated with multiple sclerosis (MS) .

HY-P1924

IRBP(651-670) human, mouse	Lipocalin Family	Inflammation/Immunology
IRBP(651-670) human, mouse represents the amino acid sequence from positions 651 to 670 of the interphotoreceptor retinoid binding protein (IRBP). IRBP(651-670) human, mouse can be used to induce experimental autoimmune uveitis .

HY-147217

Bepirovirsen ISIS 505358	HBV	Infection
Bepirovirsen is an antisense oligonucleotide targeting all HBV messenger RNAs. Bepirovirsen leads to reductions in HBV-derived RNAs, HBV DNA and viral proteins. Bepirovirsen can be used for the research of chronic HBV infection. Bepirovirsen binding site sequence (GCACTTCGCTTCACCTCTGC) .

HY-100758

FUBP1-IN-1 2 Publications Verification	DNA/RNA Synthesis	Cancer
FUBP1-IN-1 is a potent *FUSE binding protein* 1 (FUBP1)** inhibitor which interferes with the binding of FUBP1 to its single stranded target DNA FUSE sequence , with an IC₅₀ value of 11.0 μM .

HY-P3509A

PNC-28 acetate	MDM-2/p53	Cancer
PNC-28 acetate is a peptide from the mdm-2-binding domain (residues 17–26) of the p53 protein which contains a membrane crossing-penetratin sequence. PNC-28 acetate can be used for pancreatic cancer research .

HY-P1924A

IRBP(651-670) human, mouse TFA	Transmembrane Glycoprotein	Inflammation/Immunology
IRBP(651-670) human, mouse (TFA) represents the amino acid sequence from positions 651 to 670 of the interphotoreceptor retinoid binding protein (IRBP). IRBP(651-670) human, mouse (TFA) can be used to induce experimental autoimmune uveitis .

HY-P3509

PNC-28	MDM-2/p53	Cancer
PNC-28 is a peptide from the mdm-2-binding domain (residues 17–26) of the p53 protein which contains a membrane crossing-penetratin sequence. PNC-28 can be used for pancreatic cancer research .

HY-117695

AQC 4 Publications Verification 6-Aminoquinolyl-N-hydroxysccinimidyl carbamate	Fluorescent Dye	Others
AQC (6-Aminoquinolyl-N-hydroxysccinimidyl carbamate) is a reagent used for amino acid or protein sequence analysis by HPLC with fluorescence detection. AQC reacts with primary and secondary amino acids to yield fluorescent derivates, allowing amino acid detection at under-picomolar levels .

HY-P10778

me4 Peptide	Amino Acid Derivatives	Neurological Disease
me4 Peptide is a synthetic peptide designed based on the microexon me4 sequence of neuronal CPEB4 protein. me4 Peptide inhibits CPEB4 aggregation. me4 Peptide can be used in the study of disorders associated with autism spectrum disorders .

HY-172815

IDB-001	DNA/RNA Synthesis	Cancer
IDB-001 is an inhibitor of ribosome PTC that inhibits protein synthesis in a sequence-selective manner. IDB-001 inhibits HCC-1143 with EC₅₀ value of 0.84 μM. IDB-001 inhibits MYC-dependent cancer cell viability .

HY-E70370

hrv 3c Protease	Virus Protease	Others
hrv 3c Protease is a protease originated from human rhinoviruses. hrv 3c Protease recognizes the sequence LEVLFQGP and cleaves precisely between the Q and GP residues. hrv 3c Protease can be used to remove additional tags from the target proteins .

HY-NP202

C2 Protein (human)	Complement System	Inflammation/Immunology
C2 Protein (human) is a naturally glycosylated peptide with a 20 amino acid signal sequence. Complement component C2 functions as a key regulator in the early activation phase of the classical pathway and participates in the formation of the classical pathway C3 convertase C4b2a .

HY-147217A

Bepirovirsen sodium ISIS 505358 sodium	HBV	Infection
Bepirovirsen (ISIS 505358) sodium is an antisense oligonucleotide targeting all HBV messenger RNAs. Bepirovirsen sodium leads to reductions in HBV-derived RNAs, HBV DNA and viral proteins. Bepirovirsen sodium can be used for the research of chronic HBV infection. Bepirovirsen sodium binding site sequence (GCACTTCGCTTCACCTCTGC) .

HY-P1610

Asudemotide	PD-1/PD-L1	Cancer
Asudemotide (S-588410) is a peptide of human DEP domain-containing protein 1A. Asudemotide is an immunostimulant. Asudemotide has a sequence of H-Glu-Tyr-Tyr-Glu-Leu-Phe-Val-Asn-Ile-OH. Asudemotide induces a tumor immune response in esophageal cancer. .

HY-P10471E

MPSD control peptide TFA MARCKS-ED control peptide TFA	MARCKS	Others
MPSD control peptide (MARCKS-ED control peptide) TFA is the control peptide of MPSD (HY-P10471). MPSD (MARCKS-ED) is a 25-amino acid peptide based on the effector domain sequence of the intracellular membrane protein myristoylated alanine-rich C-kinase substrate (MARCKS) .

HY-P5344

Dabcyl-LNKRLLHETQ-Edans Fluorigenic PEXEL peptide	Parasite	Others
Dabcyl-LNKRLLHETQ-Edans (Fluorigenic PEXEL peptide) is a biological active peptide. (This FRET substrate peptide for Plasmepsin V (PMV) is derived from the conserved Plasmodium Export Element (PEXEL) motif of Histidine-Rich Protein II (HRPII). PMV is an ER aspartic protease that recognizes and cleaves the RXL sequence within the PEXEL motif of proteins exported by human malaria parasite Plasmodium falciparum, allowing them to translocate into host erythrocytes.)

HY-P10471

MPSD MARCKS-ED	MARCKS PKC	Others
MPSD (MARCKS-ED) is a 25-amino acid peptide based on the effector domain sequence of the intracellular membrane protein myristoylated alanine-rich C-kinase substrate (MARCKS). MPSD can sense membrane curvature and recognize phosphatidylserine. MPSD can be utilized as biological probe to study membrane shape and lipid composition .

HY-P3051

CKS-17	Reverse Transcriptase	Inflammation/Immunology
CKS-17 is a synthetic retroviral envelope peptide. CKS-17 has the highly conserved amino acid sequences occurring within the transmembrane envelope protein of many animal and human retroviruses. CKS-17 acts as an immunomodulatory epitope and exhibits suppressive properties for numerous immune functions .

HY-15435

CHAPS 3 Publications Verification	Biochemical Assay Reagents	Others
CHAPS is a non-covalent reversible stabilizer of nucleosomes derived from cholic acid (HY-N0324). CHAPS can stabilize the ultrastructure of nucleosomes, inhibit the spontaneous dissociation of nucleosomes at low concentrations, and maintain the integrity of the basic structural units of chromatin. CHAPS can promote the sliding of histone cores along the DNA chain and reduce sequence-specific binding. CHAPS can also be used as a zwitterionic detergent to dissolve membrane proteins, stabilize various protein-DNA complexes, and retain the biochemical activity of proteins in solution .

HY-15435A

CHAPS hydrate 3 Publications Verification	Biochemical Assay Reagents	Others
CHAPS hydrate is a non-covalent reversible stabilizer of nucleosomes derived from Cholic Acid (HY-N0324). CHAPS hydrate can stabilize the ultrastructure of nucleosomes, inhibit the spontaneous dissociation of nucleosomes at low concentrations, and maintain the integrity of the basic structural units of chromatin. CHAPS hydrate can promote the sliding of histone cores along the DNA chain and reduce sequence-specific binding. CHAPS hydrate can also be used as a zwitterionic detergent to dissolve membrane proteins, stabilize various protein-DNA complexes, and retain the biochemical activity of proteins in solution .

HY-149489

JH-131e-153	PKC	Neurological Disease
JH-131e-153, a diacylglycerol (DAG)-lactone, is a small molecule activator of Munc13-1, targeting the C1 domain. The activation sequence of JH-131e-153 on Munc13-1 is WT>I590≈R592A≈W588A. The C1 domain of Munc13-1 and protein kinase C (PKC) are homologous in sequence and structure. The activation sequence of JH-131e-153 on Munc13-1 and PKC was PKCα>Munc13-1>PKCε. JH-131e-153 regulates neuronal processes through Munc13-1 and can be further used in the study of neurodegenerative diseases .

HY-P11204

DDDEEKC	Peptide-Drug Conjugates (PDCs)	Others
DDDEEKC is a bioinspired peptide sequence that can selectively adsorb onto the enamel surface (mimicking the role of salivary acquired pellicle protein statherin), acting as a "target - guiding agent" for tooth enamel remineralization. DDDEEKC enhances the regeneration of hydroxyapatite (HAP). DDDEEKC is promising for research of in-situ remineralization repair of enamel demineralization damage (such as dental caries) .

HY-P5370

Scrambled β-amyloid (1-40)	Amyloid-β	Others
Scrambled β-amyloid (1-40) is a biological active peptide. (Aβ (1-40) together with Aβ (1-42) are two major C-terminal variants of the Aβ protein constituting the majority of Aβs. These undergo post-secretory aggregation and deposition in the Alzheimer’s disease brain. This peptide is the scrambled sequence of Abeta 1-40 HY-P0265)

HY-P10464

Tat-AKAP79 (326-336)	TRP Channel	Neurological Disease Inflammation/Immunology
TAT-AKAP79 326-336 is a cytoosmotic peptide. TAT-AKAP79 326-336 mimics a specific region on the AKAP79 protein that binds to TRPV1 ion channels (amino acid sequence 326-336). TAT-AKAP79 326-336 inhibits the sensitization of TRPV1 and reduce the overresponse of TRPV1 channels to stimuli caused by the activation of cellular kinases such as protein kinase A (PKA) and protein kinase C (PKC) by inflammatory mediators. TAT-AKAP79 326-336 can be used to study the mechanism of pain transduction and inflammatory hyperalgesia .

HY-P4873

Amylin (20-29) (human)	Amylin Receptor	Neurological Disease
Amylin (20-29) (human) is the fragment of human islet amyloid polypeptide (hIAPP) or Amylin. Amylin is a 37-residue hormone. Amylin (20-29) (human) is responsible for the amyloidogenic propensities of the full length protein. Amylin (20-29) (human) can be transformed into its corresponding peptoid and retropeptoid sequences, to obtain beta-sheet breaker peptides as amyloid inhibitors .

HY-101931

hVEGF-IN-1	VEGFR	Cancer
hVEGF-IN-1, a quinazoline derivative, could specifically bind to the G-rich sequence in the internal ribosome entry site A (IRES-A) and destabilize the G-quadruplex structure. hVEGF-IN-1 binds to the IRES-A (WT) with a K_d of 0.928 μM in SPR experiments. hVEGF-IN-1 could hinder tumor cells migration and repress tumor growth by decreasing VEGF-A protein expression .

HY-P991158

Rinvatercept	TGF-β Receptor	Neurological Disease
Rinvatercept, a fusion protein, is a glycyl (1)-chimeric N-terminal (1-108)-peptide (2-109) combined from the sequences of the extracellular domains of the human ACVR2A/B, and is fused via a G3 peptide linker (110-112) to an immunoglobulin G1 (IgG1) Fc fragment. Rinvatercept can be used for research of neuromuscular disease .

HY-168886

Anticancer agent 263	c-Myc	Cancer
Anticancer agent 263 (compound 7) is a potent anticancer agent. Anticancer agent 263 binds to the G-quadruplex DNA (G4) sequence 22-mer Pu22, a mimic of c-Myc DNA. Anticancer agent 263 is a structure modulator, showcasing a significant enhancement in protein α-helix formation and the capability to form supramolecular network. Anticancer agent 263 shows no cytotoxicity .

HY-155991

RUNX-IN-2	Apoptosis	Cancer
RUNX-IN-2 (Compound Conjugate 3) covalently binds to the RUNX-binding sequences, and inhibits the binding of RUNX proteins to their target sites. RUNX-IN-2 induces the p53-dependent apoptosis and inhibits cancer cell growth. RUNX-IN-2 inhibits tumor growth in PANC-1 xenograft mice. RUNX-IN-2 has high alkylation efficiency and specificity .

Cat. No.	Product Name

HY-L005

Epigenetics Compound Library

1,630 compounds

Epigenetics refers to changes in phenotype that are not rooted in DNA sequence. Many types of epigenetic processes have been identified, including DNA methylation, alteration in the structure of histone proteins and gene regulation by small noncoding microRNAs. Modification of DNA, protein, or RNA, resulting in changes to the function and/or regulation of these molecules, without altering their primary sequences, reveals the complexities of cellular differentiation, embryology, the regulation of gene expression, aging, cancer, and other diseases.

MCE provide a unique collection of 1,630 epigenetics-related compounds that can be used in the research of the related diseases.

Cat. No.	Product Name	Type

HY-130533

ReAsH-EDT2	Protein Labeling
ReAsH-EDT2 is a red fluorescent dye that marks proteins. ReAsH-EDT2 is a membrane-permeable biarsenical compound that binds covalently to tetracysteine sequences which allows the protein to be imaged. ReAsH-EDT2 can be used for protein localization and trafficking. (λ_ex=530 nm, λ_em=592 nm) .

HY-117695

AQC 4 Publications Verification 6-Aminoquinolyl-N-hydroxysccinimidyl carbamate	Fluorescent Dyes/Probes
AQC (6-Aminoquinolyl-N-hydroxysccinimidyl carbamate) is a reagent used for amino acid or protein sequence analysis by HPLC with fluorescence detection. AQC reacts with primary and secondary amino acids to yield fluorescent derivates, allowing amino acid detection at under-picomolar levels .

Cat. No.	Product Name	Type

HY-15435A

CHAPS hydrate

3 Publications Verification

Surfactants

CHAPS hydrate is a non-covalent reversible stabilizer of nucleosomes derived from Cholic Acid (HY-N0324). CHAPS hydrate can stabilize the ultrastructure of nucleosomes, inhibit the spontaneous dissociation of nucleosomes at low concentrations, and maintain the integrity of the basic structural units of chromatin. CHAPS hydrate can promote the sliding of histone cores along the DNA chain and reduce sequence-specific binding. CHAPS hydrate can also be used as a zwitterionic detergent to dissolve membrane proteins, stabilize various protein-DNA complexes, and retain the biochemical activity of proteins in solution .

HY-157881

2-Mercaptoethanesulfonic acid (ampule,3.0M±0.1M in H2O) β-Mercaptoethanesulfonic acid (ampule,3.0M±0.1M in H2O)	Buffer Reagents
2-Mercaptoethanesulfonic acid (ampule,3.0M±0.1M in H2O) is a biochemical reagent that can be used for protein sequence analysis .

HY-NP202

C2 Protein (human)	Native Proteins
C2 Protein (human) is a naturally glycosylated peptide with a 20 amino acid signal sequence. Complement component C2 functions as a key regulator in the early activation phase of the classical pathway and participates in the formation of the classical pathway C3 convertase C4b2a .

Cat. No.	Product Name	Target	Research Area

HY-P0315

Crosstide 2 Publications Verification	Akt	Others
Crosstide is a peptide analog of glycogen synthase kinase α/β fusion protein sequence which is a substrate for Akt.

HY-P0329

X-press Tag Peptide	Peptides	Others
X-press Tag Peptide is a tag peptide used for protein purification. X-press Tag is also an N-terminal leader peptide; this N-terminal peptide contains a polyhistidine sequence, the Xpress epitope (part of bacteriophage T7 gene 10 protein) and an enterokinase cleavage site. Anti-Xpress antibodies recognize the Xpress epitope sequence found in this leader peptide.

HY-P4808A

PHF6 TFA	Amyloid-β Autophagy	Neurological Disease
PHF6 (VQIVYK) TFA is a self-assembly sequence capable of initiating the full-length tau protein aggregation. PHF6 TFA is mapped to the third microtubule-binding repeat region of the tau protein .

HY-P1849A

JAG-1, scrambled TFA scJag-1 TFA	Notch	Cardiovascular Disease
JAG-1, scrambled (scJag-1) TFA is a scrambled sequence of JAG-1 (Jagged-1 protein). JAG-1, scrambled TFA has a random sequence of the amino acids that are the same as the active fragment. JAG-1, scrambled TFA is usually used as a negative control .

HY-P3732

RGD-4C	Integrin	Cancer
RGD-4C is a arginine-glycine-aspartic acid peptide (ACDCRGDCFC) with integrin binding activity. The Arg-Gly-Asp (RGD) sequence serves as the primary integrin recognition site in extracellular matrix proteins, and peptides containing this sequence can mimic the recognition specificity of the matrix proteins. RGD-4C is a αv-integrin ligand, can conjugate with bioactive molecule to exert antitumor effects in animal models .

HY-P5430

DYRKtide	DYRK	Others
DYRKtide is a biological active peptide. (Dyrktide is designed as the optimal substrate sequence efficiently phosphorylated by DYRK1A, which is a dual-specificity protein kinase that is thought to be involved in brain development.)

HY-P4749

Prion Protein (106-126) (human) (scrambled)	Peptides	Neurological Disease
Prion Protein (106-126) (human) (scrambled) is a scrambled sequence of Prion Protein (106-126). Prion Protein (106-126) (human) (scrambled) with a random sequence of the amino acids that are the same as the active fragment. Prion Protein (106-126) (human) (scrambled) usually used as a negative control .

HY-P1734

Ac-MBP (1-11)	PKC	Neurological Disease
Ac-MBP 1-11, a short peptide sequence, is the major encephalitogenic epitope in myelin basic protein (MBP) .

HY-P4808

PHF6	Amyloid-β Autophagy	Neurological Disease
PHF6 (VQIVYK) is a self-assembly sequence capable of initiating the full-length tau protein aggregation and is mapped to the third microtubule-binding repeat region of the tau protein .

HY-P1849

JAG-1, scrambled scJag-1	Peptides	Cardiovascular Disease
JAG-1, scrambled (scJag-1) is a scrambled sequence of JAG-1 (Jagged-1 protein). JAG-1, scrambled has a random sequence of the amino acids that are the same as the active fragment. JAG-1, scrambled is usually used as a negative control .

HY-P3935

Arg-Gly-Tyr-Ser-Leu-Gly	Ser/Thr Kinase	Cancer
Arg-Gly-Tyr-Ser-Leu-Gly is corresponding to the sequence of residues from 21 through 26 in lysozyme. Arg-Gly-Tyr-Ser-Leu-Gly can be used as a substrate for the protein kinase, and phosphorylated at serine residue by protein kinase .

HY-P10719

Pepinh-MYD	MyD88	Infection Inflammation/Immunology
Pepinh-MYD is a MyD88 inhibitor that contains a domain sequence from MyD88 TIR and a protein transduction sequence, enabling it to penetrate the cell membrane. Pepinh-MYD interferes with MyD88-mediated TLR signaling pathways, thereby inhibiting related immune responses. It holds potential for studying the role of MyD88 in viral infections .

HY-P10719A

Pepinh-MYD TFA	MyD88	Infection Inflammation/Immunology
Pepinh-MYD TFA is a MyD88 inhibitor that contains a domain sequence from MyD88 TIR and a protein transduction sequence, enabling it to penetrate the cell membrane. Pepinh-MYD TFA interferes with MyD88-mediated TLR signaling pathways, thereby inhibiting related immune responses. Pepinh-MYD TFA holds potential for studying the role of MyD88 in viral infections .

HY-P3541

Dirucotide MBP8298	Peptides	Neurological Disease Inflammation/Immunology
Dirucotide (MBP8298) is a synthetic peptide that consists of 17 amino acids linked in a sequence identical to that of a portion of human myelin basic protein. Dirucotide can be used for the research in autoimmune disorder of the central nervous system, such as Multiple sclerosis (MS) .

HY-P10510

R5 peptide	Biochemical Assay Reagents	Others
R5 peptide is one of the repeating peptide sequences that form the protein diatom in Cylindrotheca fusiformis. R5 peptide can be used as a template for the synthesis of Pd (palladium) nanoparticles (NPs). R5 peptide forms complexes with metal ions through the amine groups in its sequence, and the self-assembled structure of the peptide provides a confined spatial environment for the reduction of metal ions and the nucleation of nanoparticles. R5 peptide can be used in the research of biomimetic nanomaterials .

HY-P10532

Myelin basic protein, MBP (68-86)	PKC	Others Inflammation/Immunology
Myelin basic protein, MBP (68-86) is the portion of the 68th to 86th amino acid residues in the MBP protein sequence. Myelin basic protein, MBP (68-86) can act as an autoantigen, triggering the immune system to attack its own myelin. Myelin basic protein, MBP (68-86) is used as one of the immunogens in the experimental autoimmune encephalomyelitis (EAE) animal model to study immune responses associated with multiple sclerosis (MS) .

HY-P1924

IRBP(651-670) human, mouse	Lipocalin Family	Inflammation/Immunology
IRBP(651-670) human, mouse represents the amino acid sequence from positions 651 to 670 of the interphotoreceptor retinoid binding protein (IRBP). IRBP(651-670) human, mouse can be used to induce experimental autoimmune uveitis .

HY-P3817

Des-[Gly77,His78] Myelin Basic Protein (68-84), bovine	Peptides	Neurological Disease
Des-[Gly77,His78] Myelin Basic Protein (68-84) is a 68-84 sequence fragment of guinea pig myelin basic protein (GPMBP). Des-[Gly77,His78] Myelin Basic Protein (68-84) regulates functionally diverse encephalitogenic and proliferative activities of experimental autoimmune encephalomyelitis (EAE)-associated T cells .

HY-P3509A

PNC-28 acetate	MDM-2/p53	Cancer
PNC-28 acetate is a peptide from the mdm-2-binding domain (residues 17–26) of the p53 protein which contains a membrane crossing-penetratin sequence. PNC-28 acetate can be used for pancreatic cancer research .

HY-P1924A

IRBP(651-670) human, mouse TFA	Transmembrane Glycoprotein	Inflammation/Immunology
IRBP(651-670) human, mouse (TFA) represents the amino acid sequence from positions 651 to 670 of the interphotoreceptor retinoid binding protein (IRBP). IRBP(651-670) human, mouse (TFA) can be used to induce experimental autoimmune uveitis .

HY-P3509

PNC-28	MDM-2/p53	Cancer
PNC-28 is a peptide from the mdm-2-binding domain (residues 17–26) of the p53 protein which contains a membrane crossing-penetratin sequence. PNC-28 can be used for pancreatic cancer research .

HY-P10778

me4 Peptide	Amino Acid Derivatives	Neurological Disease
me4 Peptide is a synthetic peptide designed based on the microexon me4 sequence of neuronal CPEB4 protein. me4 Peptide inhibits CPEB4 aggregation. me4 Peptide can be used in the study of disorders associated with autism spectrum disorders .

HY-P1610

Asudemotide	PD-1/PD-L1	Cancer
Asudemotide (S-588410) is a peptide of human DEP domain-containing protein 1A. Asudemotide is an immunostimulant. Asudemotide has a sequence of H-Glu-Tyr-Tyr-Glu-Leu-Phe-Val-Asn-Ile-OH. Asudemotide induces a tumor immune response in esophageal cancer. .

HY-P10471E

MPSD control peptide TFA MARCKS-ED control peptide TFA	MARCKS	Others
MPSD control peptide (MARCKS-ED control peptide) TFA is the control peptide of MPSD (HY-P10471). MPSD (MARCKS-ED) is a 25-amino acid peptide based on the effector domain sequence of the intracellular membrane protein myristoylated alanine-rich C-kinase substrate (MARCKS) .

HY-115379

Latromotide	Peptides	Cancer
Latromotide is a synthetic peptide with antineoplastic activity. It consists of 10 amino acids corresponding to amino acid residues 66-75 of the human kinesin-like protein KIF20A. Latromotide has a sequence of H-Lys-Val-Tyr-Leu-Arg-Val-Arg-Pro Leu-Leu-OH .

HY-P5344

Dabcyl-LNKRLLHETQ-Edans Fluorigenic PEXEL peptide	Parasite	Others
Dabcyl-LNKRLLHETQ-Edans (Fluorigenic PEXEL peptide) is a biological active peptide. (This FRET substrate peptide for Plasmepsin V (PMV) is derived from the conserved Plasmodium Export Element (PEXEL) motif of Histidine-Rich Protein II (HRPII). PMV is an ER aspartic protease that recognizes and cleaves the RXL sequence within the PEXEL motif of proteins exported by human malaria parasite Plasmodium falciparum, allowing them to translocate into host erythrocytes.)

HY-P10471

MPSD MARCKS-ED	MARCKS PKC	Others
MPSD (MARCKS-ED) is a 25-amino acid peptide based on the effector domain sequence of the intracellular membrane protein myristoylated alanine-rich C-kinase substrate (MARCKS). MPSD can sense membrane curvature and recognize phosphatidylserine. MPSD can be utilized as biological probe to study membrane shape and lipid composition .

HY-P3051

CKS-17	Reverse Transcriptase	Inflammation/Immunology
CKS-17 is a synthetic retroviral envelope peptide. CKS-17 has the highly conserved amino acid sequences occurring within the transmembrane envelope protein of many animal and human retroviruses. CKS-17 acts as an immunomodulatory epitope and exhibits suppressive properties for numerous immune functions .

HY-P11204

DDDEEKC	Peptide-Drug Conjugates (PDCs)	Others
DDDEEKC is a bioinspired peptide sequence that can selectively adsorb onto the enamel surface (mimicking the role of salivary acquired pellicle protein statherin), acting as a "target - guiding agent" for tooth enamel remineralization. DDDEEKC enhances the regeneration of hydroxyapatite (HAP). DDDEEKC is promising for research of in-situ remineralization repair of enamel demineralization damage (such as dental caries) .

HY-P10477

CT-08	Peptides	Cancer
CT-08 (CT8, Compound 3) is a macrocyclic Sec61 modulator, blocks protein secretion in a signal sequence-dependent manner. CT-08 blocks Sec61-mediated translocation of VCAMss-GLuc into the ER, resulting in a loss of luciferase activity. CT-08 inhibits VCAM expression in transfected cells .

HY-P5370

Scrambled β-amyloid (1-40)	Amyloid-β	Others
Scrambled β-amyloid (1-40) is a biological active peptide. (Aβ (1-40) together with Aβ (1-42) are two major C-terminal variants of the Aβ protein constituting the majority of Aβs. These undergo post-secretory aggregation and deposition in the Alzheimer’s disease brain. This peptide is the scrambled sequence of Abeta 1-40 HY-P0265)

HY-P10464

Tat-AKAP79 (326-336)	TRP Channel	Neurological Disease Inflammation/Immunology
TAT-AKAP79 326-336 is a cytoosmotic peptide. TAT-AKAP79 326-336 mimics a specific region on the AKAP79 protein that binds to TRPV1 ion channels (amino acid sequence 326-336). TAT-AKAP79 326-336 inhibits the sensitization of TRPV1 and reduce the overresponse of TRPV1 channels to stimuli caused by the activation of cellular kinases such as protein kinase A (PKA) and protein kinase C (PKC) by inflammatory mediators. TAT-AKAP79 326-336 can be used to study the mechanism of pain transduction and inflammatory hyperalgesia .

HY-P4873

Amylin (20-29) (human)	Amylin Receptor	Neurological Disease
Amylin (20-29) (human) is the fragment of human islet amyloid polypeptide (hIAPP) or Amylin. Amylin is a 37-residue hormone. Amylin (20-29) (human) is responsible for the amyloidogenic propensities of the full length protein. Amylin (20-29) (human) can be transformed into its corresponding peptoid and retropeptoid sequences, to obtain beta-sheet breaker peptides as amyloid inhibitors .

HY-P10491

MAGE A4 (230-239)	Peptides	Cancer
MAGE A4 (230-239) is a peptide sequence derived from the MAGE-A4 protein. MAGE A4 (230-239) is an immunogenic epitope that can activate T cells and trigger the killing of tumor cells expressing MAGE-A4. MAGE A4 (230-239) is used in the development of next-generation T cell-based immunotherapies .

HY-P10471A

MPSD TFA MARCKS-ED TFA	MARCKS PKC	Others
MPSD TFA (MARCKS-ED TFA) is the TFA salt form of MPSD (HY-P10471). MPSD TFA is a 25-amino acid peptide based on the effector domain sequence of the intracellular membrane protein myristoylated alanine-rich C-kinase substrate (MARCKS). MPSD TFA can sense membrane curvature and recognize phosphatidylserine. MPSD TFA can be utilized as biological probe to study membrane shape and lipid composition .

HY-P10457

15-Hydroxy prostaglandin dehydrogenase blocking peptide 15-PGDH (92-105)	15-PGDH	Others
5-Hydroxy prostaglandin dehydrogenase blocking peptide (15-PGDH (92-105)) is a blocking peptide that corresponds to the amino acids (AGVNNEKNWEKTLQ) located at positions 92-105 of the 15-hydroxy prostaglandin dehydrogenase (15-PGDH) sequence. 5-Hydroxy prostaglandin dehydrogenase blocking peptide can block the formation of protein-antibody complexes during immunohistochemical analysis of 15-PGDH .

HY-P5483

Retro-indolicidin	Bacterial	Others
Retro-indolicidin is a biological active peptide. (Reverse peptide of indolicidin (Rev4) is a 13-amino acid residue peptide based on the sequence of indolicidin. Indolicidin, a member of the cathelicidin protein family, is a 13-amino acid residue cationic, antimicrobial peptide-amide isolated from the cytoplasmic granules of bovine neutrophils. The synthetic peptide Rev4 has been shown to possess strong antimicrobial as well as protease inhibitory activities in vitro.)

HY-P10471D

MPSD control peptide MARCKS-ED control peptide	MARCKS PKC	Others
MPSD control peptide (MARCKS-ED control peptide) is a control peptide for MPSD peptide (HY-P10471). MPSD (MARCKS-ED) is a 25-amino acid peptide based on the effector domain sequence of the intracellular membrane protein myristoylated alanine-rich C-kinase substrate (MARCKS). MPSD can sense membrane curvature and recognize phosphatidylserine. MPSD can be utilized as biological probe to study membrane shape and lipid composition .

HY-P10295

p53 (232-240)	MDM-2/p53	Cancer
p53 (232-240) is a peptide segment of the 232-240 amino acid sequence of the human tumor suppressor protein p53. p53 (232-240) enhances its binding affinity to the Major histocompatibility complex (MHC), thereby enhancing the immunogenicity of this peptide to enhance the immune system's response to tumor antigens. p53 (232-240) can be used in the development of cancer vaccines and in the study of tumor cell recognition and clearance by the immune system .

HY-P10055

PSMA targeting peptide PSMA-1	PSMA	Cancer
PSMA-1 is a PSMA targeting peptide (GRFLTGGTGRLLRIS) and can be used for for targeted delivery of glucose-regulated protein (GRP)-silencing siRNAs in PCa cells. PSMA-1 is selected and polyarginine sequences R6 or R9 were added at the C terminus to generate the CTPs. FITC labeling of the peptide with an aminohexanoic acid (Ahx) linker at the N terminus produced FITC-PSMA-1，to track PSMA binding on PCa cells .

HY-P10553

ARF(26–44), cell-permeable	Apoptosis	Cancer
ARF(26–44), cell-permeable is a cell-penetrating peptide derived from a specific amino acid sequence of the p14ARF tumor suppressor protein. As a functional inhibitor of FoxM1, ARF(26–44) cell-permeable shows significant anti-tumor activity in the treatment of mouse hepatocellular carcinoma (HCC), significantly increasing tumor cell apoptosis and reducing tumor cell proliferation and angiogenesis. ARF(26–44), cell-permeable can be used in research on tumor therapy .

HY-P10607

IALYLQQNW	EBV	Cancer
IALYLQQNW is a specific nonapeptide sequence derived from the tumor-associated antigen latent membrane protein 1 (LMP1) encoded by Epstein-Barr virus (EBV). As a latent T-cell epitope, IALYLQQNW is able to activate EBV-specific cytotoxic T lymphocytes (CTLs), which are able to recognize and kill EBV-infected cells expressing LMP1. IALYLQQNW plays an important role in the immune response against EBV-associated tumors and can be used in the study of Hodgkin's disease and nasopharyngeal carcinoma .

HY-P10496

MAGE-A1-derived peptide	Peptides	Cancer
MAGE-A1-derived peptide is a short peptide sequence derived from MAGE-A1 protein. As a tumor-specific antigen, MAGE-A1-derived peptide can be recognized and activated by cytotoxic T lymphocytes (CTLs), thereby generating an immune response to tumor cells expressing MAGE-A1. This immune response can lead to the lysis and death of tumor cells. MAGE-A1-derived peptide can be used in the study of tumor immunity .

HY-P10496A

MAGE-A1-derived peptide acetate	Peptides	Cancer
MAGE-A1-derived peptide acetate is a short peptide sequence derived from MAGE-A1 protein. As a tumor-specific antigen, MAGE-A1-derived peptide acetate can be recognized and activated by cytotoxic T lymphocytes (CTLs), thereby generating an immune response to tumor cells expressing MAGE-A1. This immune response can lead to the lysis and death of tumor cells. MAGE-A1-derived peptide acetate can be used in the study of tumor immunity .

HY-P5395

TAT-GluR23A Fusion Peptide	HIV	Others
TAT-GluR23A Fusion Peptide is a biological active peptide. (This is the GluR23A sequence, a control inactive peptide used as a mutant counterpart to glutamate receptor endocytosis inhibitor (GluR23Y), connected to an 11 amino acid cell permeable HIV Trans-Activator of Transcription (TAT) protein transduction domain (PTD). GluR23A is derived from GluR23Y amino acids 869 to 877, with Ala substituted for Tyr, and thus lacking essential phosphorylation sites.Control peptide of HY-P2259)

HY-P5439

Epsilon-V1-2, Cys-conjugated	PKC MARCKS	Others
Epsilon-V1-2, Cys-conjugated is a biological active peptide. (This peptide is the εPKC specific inhibitor. Its inhibitory activity is based on εPKC translocation and MARCKS phosphorylation. This peptide interferes with εPKC interaction with the anchoring protein εRACK. This peptide contains a cysteine residue added to the C-terminus for potential S-S bond formation with a carrier protein.Pyroglutamyl (pGlu) peptides may spontaneously form when either Glutamine (Q) or Glutamic acid (E) is located at the sequence N-terminus. The conversion of Q or E to pGlu is a natural occurrence and in general it is believed that the hydrophobic γ-lactam ring of pGlu may play a role in peptide stability against gastrointestinal proteases. Pyroglutamyl peptides are therefore considered a normal subset of such peptides and are included as part of the peptide purity during HPLC analysis.)

HY-P5429

DNA-PK Substrate	Peptides	Others
DNA-PK Substrate is a biological active peptide. (A substrate for DNA-dependent protein kinase (DNA-PK), phosphorylation. DNA-PK is essential for the repair of DNA double-strand breaks. This peptide corresponding to 11–24 amino acids of human p53 with threonine 18 and serine 20 changed to alanine is used as a substrate for the assay of DNA-PK activityPyroglutamyl (pGlu) peptides may spontaneously form when either Glutamine (Q) or Glutamic acid (E) is located at the sequence N-terminus. The conversion of Q or E to pGlu is a natural occurrence and in general it is believed that the hydrophobic γ-lactam ring of pGlu may play a role in peptide stability against gastrointestinal proteases. Pyroglutamyl peptides are therefore considered a normal subset of such peptides and are included as part of the peptide purity during HPLC analysis.)

HY-P5325

Bid BH3 (80-99)	Bcl-2 Family	Others
Bid BH3 (80-99) is a biological active peptide. (BID is a pro-apoptotic member of the 'BH3-only' (BOPS) subset of the BCL-2 family of proteins that constitute a critical control point in apoptosis. Bid is the first of the BOPs reported to bind and activate Bcl-2, Bax, and Bak. Bid serves as a death-inducing ligand that moves from the cytosol to the mitochondrial membrane to inactivate Bcl-2 or to activate Bax.Pyroglutamyl (pGlu) peptides may spontaneously form when either Glutamine (Q) or Glutamic acid (E) is located at the sequence N-terminus. The conversion of Q or E to pGlu is a natural occurrence and in general it is believed that the hydrophobic γ-lactam ring of pGlu may play a role in peptide stability against gastrointestinal proteases. Pyroglutamyl peptides are therefore considered a normal subset of such peptides and are included as part of the peptide purity during HPLC analysis.)

Cat. No.	Product Name	Target	Research Area

HY-P991158

Rinvatercept	TGF-β Receptor	Neurological Disease
Rinvatercept, a fusion protein, is a glycyl (1)-chimeric N-terminal (1-108)-peptide (2-109) combined from the sequences of the extracellular domains of the human ACVR2A/B, and is fused via a G3 peptide linker (110-112) to an immunoglobulin G1 (IgG1) Fc fragment. Rinvatercept can be used for research of neuromuscular disease .

HY-P990088

Sotiburafusp alfa	VEGFR PD-1/PD-L1	Cardiovascular Disease
Sotiburafusp alfa is a bispecific fusion protein, which is a humanized VEGFR-1 extracellular domain fragment (129-228, 1-100 in the current sequence) fused via the peptide linker ¹⁰¹GGSGGSGGSGGSGGS ¹¹⁵ to the N-terminus of the heavy chain (116-564) of a humanized IgG1-kappa anti-human PD-L1 heavy chain variant L352>A, L353>A. Sotiburafusp alfa is also an angiogenesis inhibitor .

Cat. No.	Product Name	Category	Target	Chemical Structure

HY-W040129

Chromomycin A3 1 Publications Verification	Microorganisms Source classification	DNA Alkylator/Crosslinker DNA/RNA Synthesis Apoptosis Caspase
Chromomycin A3 is an inhibitor that selectively binds to GC-rich DNA sequences. Chromomycin A3 targets the DNA minor groove after forming a dimer with Mg ²⁺. Chromomycin A3 inhibits DNA replication and transcription, blocks the binding of Sp1 transcription factor to target gene promoters, downregulates the expression of anti-apoptotic proteins such as FLIP, Mcl-1, and XIAP, and induces S-phase cycle arrest and caspase-dependent apoptosis in tumor cells. Chromomycin A3 can antagonize oxidative stress induced by glutathione depletion and neuronal apoptosis induced by Camptothecin (HY-15660). Chromomycin A3 can be used in basic research on malignant tumors such as cholangiocarcinoma, and is a potential chemosensitizer and GC-rich region probe .

HY-N0086R

N6-Methyladenosine (Standard) 6-Methyladenosine (Standard); N-Methyladenosine (Standard)	Structural Classification Natural Products Microorganisms Source classification Endogenous metabolite	Endogenous Metabolite Influenza Virus Reference Standards
N6-Methyladenosine (Standard) is the analytical standard of N6-Methyladenosine. This product is intended for research and analytical applications. N6-Methyladenosine is the most prevalent internal (non-cap) modification present in the messenger RNA (mRNA) of all higher eukaryotes. N6-Methyladenosine can modifies viral RNAs and has antiviral activities. In Vitro: N6-methyladenosine (m6A) is selectively recognized by the human YTH domain family 2 (YTHDF2) protein to regulate mRNA degradation. N6-methyladenosine (m6A), a prevalent internal modification in the messenger RNA of all eukaryotes, is post-transcriptionally installed by m6A methyltransferase (e.g., MT-A70) within the consensus sequence of G(m6A)C (70%) or A(m6A)C (30%). N6-methyladenosine (m6A)-containing RNAs are greatly enriched in the YTHDF-bound portion and diminished in the flow-through portion . N6-methyladenosine (m6A), the most abundant internal RNA modification, functions in diverse biological processes, including regulation of embryonic stem cell self-renewal and differentiation. N6-methyladenosine (m6A) is a large protein complex, consisting in part of methyltransferase-like 3 (METTL3) and methyltransferase-like 14 (METTL14) catalytic subunits .

HY-W040129R

Chromomycin A3 (Standard)	Microorganisms Source classification	Reference Standards Bacterial Fungal Apoptosis Antibiotic
Chromomycin A3 (Standard) is the analytical standard of Chromomycin A3 (HY-W040129). This product is intended for research and analytical applications. Chromomycin A3 is an inhibitor that selectively binds to GC-rich DNA sequences. Chromomycin A3 targets the DNA minor groove after forming a dimer with Mg ²⁺. Chromomycin A3 inhibits DNA replication and transcription, blocks the binding of Sp1 transcription factor to target gene promoters, downregulates the expression of anti-apoptotic proteins such as FLIP, Mcl-1, and XIAP, and induces S-phase cycle arrest and caspase-dependent apoptosis in tumor cells. Chromomycin A3 can antagonize oxidative stress induced by glutathione depletion and neuronal apoptosis induced by Camptothecin (HY-15660). Chromomycin A3 can be used in basic research on malignant tumors such as cholangiocarcinoma, and is a potential chemosensitizer and GC-rich region probe .

Species:	Human (26) Mouse (2) Cynomolgus (1)
Tag:	His (15) T7 (1) Tag Free (2) Strep (1) Avi (2) Myc (3) GST (3) Fc (8)
Source:	HEK293 (19) Sf9 insect cells (1) P. pastoris (1) E. coli (8)

Cat. No.	Compare	Product Name	Species	Source

HY-P70157

	MICA Protein, Human (HEK293, His) rHuMHC class I polypeptide-related sequence A/MICA, His ; MHC Class I Polypeptide-Related sequence A; MIC-A; MICA; PERB11.1	Human	HEK293
	MICA is a ligand for the stress signaling protein and natural killer (NK) cell activating receptor KLRK1/NKG2D. Tumor cells shed the expressed MICA protein and undergo immune evasion. MICA Protein, Human (HEK293, His) is the recombinant human-derived MICA protein, expressed by HEK293 , with C-6*His labeled tag.

HY-P700271

	BCAS2 Protein, Human (N-GST) rHuBCAS2, His, N-T7; Pre-mRNA-Splicing Factor SPF27; Breast Carcinoma-Amplified sequence 2; Spliceosome-Associated protein SPF 27; BCAS2	Human	E. coli
	BCAS2 is essential for pre-mRNA splicing and is critical for spliceosome activation as a key component of the activated spliceosome and the PRP19-CDC5L complex. It may act as a scaffold in spliceosome assembly, forming contacts with core components. BCAS2 Protein, Human (N-GST) is the recombinant human-derived BCAS2 protein, expressed by E. coli , with N-GST labeled tag.

HY-P76686

	TSPAN31 Protein, Human (HEK293, Fc) Tetraspanin-31; Tspan-31; Sarcoma-amplified sequence; SAS	Human	HEK293
	TSPAN31 is a member of the tetraspanin protein family, which has four hydrophobic domains. TSPAN31 mediates signal transduction events and plays a role in the regulation of cell development, activation, growth, and movement. TSPAN31 is also associated with tumorigenesis and osteosarcoma. TSPAN31 Protein, Human (HEK293, Fc) is the recombinant human-derived TSPAN31 protein, expressed by HEK293 , with N-mFc labeled tag.

HY-P7649

	BCAS2 Protein, Human (His, T7) rHuBCAS2, His, N-T7; Pre-mRNA-Splicing Factor SPF27; Breast Carcinoma-Amplified sequence 2; Spliceosome-Associated protein SPF 27; BCAS2	Human	E. coli
	BCAS2 Protein, Human (His, T7) plays crucial roles in pre-mRNA splicing and androgen receptor transcription. BCAS2 helps repair radiation-induced DSBs efficiently in both human PCa cells and Drosophila.

HY-P73294

	MICB Protein, Human (HEK293, His) MHC class I polypeptide-related sequence B; MIC-B; PERB11.2	Human	HEK293
	MICB Protein, a heavily glycosylated ligand for NKG2D receptor, triggers cytolytic response in immune cells. It resembles MHC class I molecules but lacks association with beta-2-microglobulin or peptide binding. Alternative splicing leads to multiple transcript variants. MICB is widely expressed, especially in lymph nodes and bone marrow, highlighting its immune response role in diverse physiological contexts. MICB Protein, Human (HEK293, His) is the recombinant human-derived MICB protein, expressed by HEK293 , with C-His, C-6*His labeled tag.

HY-P75928

	MICA Protein, Cynomolgus (HEK293, His) MHC class I polypeptide-related sequence A; MIC-A; PERB11.1	Cynomolgus	HEK293
	MICA Protein, Cynomolgus (HEK293, His) is the recombinant cynomolgus-derived MICA, expressed by HEK293 , with C-His labeled tag. ,

HY-P70579

	MICA Protein, Human (HEK293, Fc) MHC Class I Polypeptide-Related sequence A; MIC-A; MICA; PERB11.1	Human	HEK293
	MICA is a ligand for the stress signaling protein and natural killer (NK) cell activating receptor KLRK1/NKG2D. Tumor cells shed the expressed MICA protein and undergo immune evasion. MICA Protein, Human (HEK293, Fc) is the recombinant human-derived MICA protein, expressed by HEK293 , with C-hFc labeled tag.

HY-P704788

	MICA Protein, Human (HEK293, IgG4 Fc) rHuMHC class I polypeptide-related sequence A/MICA, His ; MHC Class I Polypeptide-Related sequence A; MIC-A; MICA; PERB11.1	Human	HEK293
	MICA Protein, Human (HEK293, IgG4 Fc) is the recombinant human-derived MICA protein, expressed by HEK293, with C-hFc tag.

HY-P73293

	MICB Protein, Human (HEK293, His-Fc) MHC class I polypeptide-related sequence B; MIC-B; PERB11.2	Human	HEK293
	In contrast to antigen presentation, MICB proteins serve as stress-induced autoantigens and are recognized by γδ T cells. As a ligand for the KLRK1/NKG2D receptor, binding of MICB results in cell lysis. MICB Protein, Human (HEK293, His-Fc) is the recombinant human-derived MICB protein, expressed by HEK293 , with C-hFc, C-His labeled tag.

HY-P704789

	MICB Protein, Human (286a.a., HEK293, His) MHC class I polypeptide-related sequence B; MIC-B; PERB11.2	Human	HEK293
	MICB Protein, Human (286a.a., HEK293, His) is the recombinant human-derived MICB protein, expressed by HEK293, with C-His tag.

HY-P704964

	MICA Protein, Human (179a.a, HEK293, mFc) MHC Class I Polypeptide-Related sequence A; MIC-A; MICA; PERB11.1	Human	HEK293

HY-P704965

	MICA Protein, Human (179a.a, HEK293, Llama Fc) MHC Class I Polypeptide-Related sequence A; MIC-A; MICA; PERB11.1	Human	HEK293

HY-P700585

	AXL Protein, Human (D266N, HEK293, His) AXL receptor tyrosine kinase; tyrosine-protein kinase receptor UFO; JTK11; UFO; AXL oncogene; oncogene AXL; AXL transforming sequence/gene	Human	HEK293
	AXL protein is a receptor tyrosine kinase that mediates signals by binding to GAS6 and regulates cell survival, proliferation, migration and differentiation. After ligand binding, AXL dimerizes and autophosphorylates, activating downstream molecules, such as PI3 kinase subunits, GRB2, PLCG1, etc. AXL Protein, Human (D266N, HEK293, His) is the recombinant human-derived AXL protein, expressed by HEK293 , with C-10*His labeled tag and D266N mutation.

HY-P700586

	AXL Protein, Human (D266N, HEK293, hFc) AXL receptor tyrosine kinase; tyrosine-protein kinase receptor UFO; JTK11; UFO; AXL oncogene; oncogene AXL; AXL transforming sequence/gene	Human	HEK293
	AXL protein is a receptor tyrosine kinase that mediates signals by binding to GAS6 and regulates cell survival, proliferation, migration and differentiation. After ligand binding, AXL dimerizes and autophosphorylates, activating downstream molecules, such as PI3 kinase subunits, GRB2, PLCG1, etc. AXL Protein, Human (D266N, HEK293, hFc) is the recombinant human-derived AXL protein, expressed by HEK293 , with C-hFc labeled tag and D266N mutation.

HY-P702703

	AXL Protein, Human (Biotinylated, sf9, GST, Avi) AXL; AXL receptor tyrosine kinase; tyrosine-protein kinase receptor UFO; JTK11; UFO; AXL oncogene; oncogene AXL; AXL transforming sequence/gene	Human	Sf9 insect cells
	AXL protein is a receptor tyrosine kinase that mediates signals by binding to GAS6 and regulates cell survival, proliferation, migration and differentiation. After ligand binding, AXL dimerizes and autophosphorylates, activating downstream molecules, such as PI3 kinase subunits, GRB2, PLCG1, etc. AXL Protein, Human (Biotinylated, sf9, GST, Avi) is the recombinant human-derived AXL, expressed by Sf9 insect cells, with GST, Avi labeled tag. The total length of AXL Protein, Human (Biotinylated, sf9, GST, Avi) is 422 a.a..

HY-P704982

	AXL Protein, Human (Biotinylated, HEK293, Fc-Avi) AXL; AXL receptor tyrosine kinase; tyrosine-protein kinase receptor UFO; JTK11; UFO; AXL oncogene; oncogene AXL; AXL transforming sequence/gene	Human	HEK293

HY-P71639

	CORS26 Protein, Mouse (Myc, His) C1qtnf3; Cors26; Ctrp3; Complement C1q tumor necrosis factor-related protein 3; Collagenous repeat-containing sequence 26kDa protein; CORS26; Secretory protein CORS26	Mouse	E. coli
	CORS26 Protein is a secreted protein of the C1q/ TNF-associated protein (CTRPs) family. CORS26 Protein involved in the LAMP1-STAT3, SIRT1/NF-魏B/p53, NF-魏B and TGF-尾1/Smad3 pathways play anti-inflammatory effects. CORS26 Protein also inhibited the expression of antimicrobial peptide (CAMP) in adipocytes induced by toll-like receptors (TLR). CORS26 Protein, Mouse (Myc, His) is the recombinant mouse-derived CORS26 protein, expressed by E. coli , with N-His, C-Myc labeled tag.

HY-P79169

	TAFA1/FAM19A1 Protein, Human TAFA Chemokine Like Family Member 1; FAM19A1; TAFA-1; Family With sequence Similarity 19 Member A1, C-C Motif Chemokine Like; Chemokine-Like protein TAFA-1; Family With sequence Similarity 19 (Chemokine (C-C Motif)-Like), Member A1; protein FAM19A1; Famil	Human	E. coli
	The Dll3 protein is a transmembrane ligand that plays a critical role in regulating cell differentiation and patterning during embryonic development. It participates in the Notch signaling pathway and helps determine cell fate. TAFA1/FAM19A1 Protein, Human is the recombinant human-derived TAFA1/FAM19A1 protein, expressed by E. coli , with tag free.

HY-P704225

	MICA Protein, Human (179a.a, HEK293, His) MHC Class I Polypeptide-Related sequence A; L MIC-A; L MICA; L PERB11.1	Human	HEK293
	MICA protein is recognized by γδ T cells as a stress-induced autoantigen independent of antigen presentation. As a ligand for the KLRK1/NKG2D receptor, MICA binding triggers cell lysis. MICA Protein, Human (179a.a, HEK293, His) is the recombinant human-derived MICA protein, expressed by HEK293, with C-His labeled tag.

HY-P71677

	FAM20C Protein, Human (HEK293, Myc, His) C76981; Dentin matrix protein 4; Family with sequence similarity 20 member C; GEF CK; Golgi enriched fraction casein kinase; protein FAM20C; RNS	Human	HEK293
	The FAM20C protein is a Golgi kinase that phosphorylates secretory pathway proteins and contributes to the biomineralization of bones and teeth. FAM20C phosphorylates caseins and proteins involved in biomineralization and also affects lipid homeostasis, wound healing, and cell migration and adhesion. FAM20C Protein, Human (HEK293, Myc, His) is the recombinant human-derived FAM20C protein, expressed by HEK293 , with N-His, C-Myc labeled tag.

HY-P700616

	ANO1/Anoctamin-1 Protein, Human (N-His, C-Myc) anoctamin 1, calcium activated chloride channel; oral cancer overexpressed 2, ORAOV2, TMEM16A, transmembrane protein 16A; anoctamin-1; DOG1; FLJ10261; TAOS2; oral cancer overexpressed 2; tumor-amplified and overexpressed sequence 2; discovered on gastrointestinal stromal tumors protein 1; transmembrane protein 16A (eight membrane-spanning domains); ORAOV2; TMEM16A	Human	E. coli
	ANO1/Anoctamin-1 protein, a calcium-activated chloride channel (CaCC), is involved in ion transport, smooth muscle contraction, and mucus secretion. ANO1/Anoctamin-1 Protein, Human (N-His, C-Myc) is the recombinant human-derived ANO1/Anoctamin-1 protein, expressed by E. coli , with C-Myc, N-10*His labeled tag.

HY-P71350

	TAFA4 Protein, Human (His) protein FAM19A4; Chemokine-like protein TAFA-4; TAFA4; family with sequence similarity 19 (chemokine (C-C motif)-like); member A4; FAM19A4; chemokine-like protein TAFA-4	Human	E. coli
	TAFA4 protein, a modulator of injury-induced and chemical pain hypersensitivity, influences pain responses. It serves as a ligand for FPR1, chemoattracting macrophages, enhancing phagocytosis, and elevating reactive oxygen species (ROS) release. TAFA4's multifaceted role indicates involvement in immune responses and cellular processes related to inflammation and injury. TAFA4 Protein, Human (His) is the recombinant human-derived TAFA4 protein, expressed by E. coli , with N-6*His labeled tag.

HY-P701118

	NIP30 Protein, Human (HEK293, His) FAM192A; CDA10; NIP30; CDA018; C16orf94; family with sequence similarity 192, member A; protein FAM192A; NEFA-interacting nuclear protein NIP30	Human	HEK293
	The NIP30 protein negatively regulates proteasomal protein catabolism and protein binding activity. It is located in the nucleus and is expressed in various tissues including the brain and testis. NIP30 Protein, Human (HEK293, His) is the recombinant human-derived NIP30 protein, expressed by HEK293 , with C-His labeled tag.

HY-P700509

	TFF1 Protein, Human (P. pastoris, N-His) TFF1; BCEI; D21S21; HP1.A; HPS2; pNR-2; pS2; trefoil factor 1; gastrointestinal trefoil protein pS2; breast cancer estrogen-inducible sequence; Breast cancer estrogen-inducible protein; breast cancer, estrogen-inducible sequence expressed in gastrointestinal trefoil protein pS2; pS2 protein; trefoil factor, BCE1, human pS2 induced by estrogen from human breast cancer cell line M	Human	P. pastoris
	TFF1 protein functions as a mucous gel stabilizer, vital for fortifying the gastrointestinal mucosa against noxious agents. It contributes to the mucous layer's integrity, providing a crucial physical barrier for the gastrointestinal tract, safeguarding it from potential harm. TFF1's stabilizing role emphasizes its significance in preserving the mucosal barrier, essential for overall gastrointestinal health and protection. TFF1 Protein, Human (P. pastoris, N-His) is the recombinant human-derived TFF1 protein, expressed by P. pastoris , with N-6*His labeled tag.

HY-P70161

	LYVE-1 Protein, Human (HEK293, His) rHuLymphatic vessel endothelial hyaluronic acid receptor 1/LYVE-1, His; Lymphatic Vessel Endothelial Hyaluronic Acid Receptor 1; LYVE-1; Cell Surface Retention sequence-Binding protein 1; CRSBP-1; Extracellular Link Domain-Containing protein 1; Hyaluronic Acid Receptor; LYVE1; CRSBP1; HAR; XLKD1	Human	HEK293
	The LYVE-1 protein is a ligand-specific transporter that regulates molecular transport between the trans-Golgi network (TGN) and the plasma membrane. It plays a key role in autocrine cell growth regulation, mediating the uptake and catabolism of growth regulators through cell surface retention sequences. LYVE-1 Protein, Human (HEK293, His) is the recombinant human-derived LYVE-1 protein, expressed by HEK293 , with C-6*His labeled tag.

HY-P71928

	TFF1 Protein, Human BCEI; Breast cancer estrogen inducible protein; Breast cancer estrogen inducible sequence; Breast cancer estrogen-inducible protein; D21S21; Gastrointestinal trefoil protein; Gastrointestinal trefoil protein pS2; hP1.A; HP1A; HPS 2; HPS2; pNR 2; PNR-2; pNR2; Polypeptide P1.A; protein pS2; PS 2; pS2; pS2 protein; TFF 1; TFF1; TFF1_HUMAN; Trefoil factor 1	Human	E. coli
	TFF1 protein functions as a mucous gel stabilizer, vital for fortifying the gastrointestinal mucosa against noxious agents. It contributes to the mucous layer's integrity, providing a crucial physical barrier for the gastrointestinal tract, safeguarding it from potential harm. TFF1's stabilizing role emphasizes its significance in preserving the mucosal barrier, essential for overall gastrointestinal health and protection. TFF1 Protein, Human is the recombinant human-derived TFF1 protein, expressed by E. coli , with tag free.

HY-P72171

	DEFA1 Protein, Human (GST) 1 Publications Verification alpha 1; DEF1; DEF1_HUMAN; DEFA1; DEFA1B; DEFA2; Defensin 1; Defensin; Defensin; alpha 1; Defensin; alpha 1; myeloid related sequence; Defensin; alpha 2; HNP-1; HNP-2; HNP1; HP-1; HP-2; HP1; HP2; MRS; Myeloid related sequence; Neutrophil defensin 1; Neutrophil defensin 2	Human	E. coli
	The DEFA1 protein is a multifunctional effector in innate immunity that exhibits antibiotic-like properties against bacteria, fungi, and viruses. It promotes immune defense by activating antigen-presenting cells (APCs) and inhibiting bacterial cell wall synthesis by interacting with lipid II. DEFA1 Protein, Human (GST) is the recombinant human-derived DEFA1 protein, expressed by E. coli , with N-GST labeled tag.

HY-P704562

	DEFA1 Protein, Human (HEK293, Twin Strep) alpha 1; DEF1; DEF1_HUMAN; DEFA1; DEFA1B; DEFA2; Defensin 1; Defensin; Defensin; alpha 1; Defensin; alpha 1; myeloid related sequence; Defensin; alpha 2; HNP-1; HNP-2; HNP1; HP-1; HP-2; HP1; HP2; MRS; Myeloid related sequence; Neutrophil defensin 1; Neutrophil defensin 2	Human	HEK293
	The DEFA1 protein is a multifunctional effector in innate immunity that exhibits antibiotic-like properties against bacteria, fungi, and viruses. It promotes immune defense by activating antigen-presenting cells (APCs) and inhibiting bacterial cell wall synthesis by interacting with lipid II. DEFA1 Protein, Human (HEK293, Twin Strep) is the recombinant human-derived DEFA1 protein, expressed by HEK293, with C-Twin-Strep labeled tag.

HY-P702542

	RET Protein, Mouse (HEK293, His) CDHF12MTC1; CDHR16; EC 2.7.10; Hirschsprung disease 1; Hirschsprung disease); MEN2A; MEN2B; multiple endocrine neoplasia and medullary thyroid carcinoma 1; ret proto-oncogene; RET transforming sequence; Ret	Mouse	HEK293
	RET protein is an important receptor tyrosine protein kinase that drives a variety of cellular processes such as proliferation, migration, and differentiation when bound to GDNF ligand. It coordinates organogenesis, shapes the enteric nervous system and promotes kidney development. RET Protein, Mouse (HEK293, His) is the recombinant mouse-derived RET protein, expressed by HEK293 , with C-6*His labeled tag and F174S mutation.

Compare Products


Products	In-stock - + Add to Cart
Cat. No.
Species
Source
Tag
Accession
Gene ID
Molecular Weight
Purity
Endotoxin Level
Biological Activity
Appearance
Formulation
Storage & Stability
Shipping
Free Sample	Yes No
Size	* This product has been "discontinued". Optimized version of product available: / In-stock - + Add to Cart Get quote

Cat. No.	Compare	Product Name	Application	Reactivity

HY-P83515

	TATA Box Binding Protein Antibody (YA3260) TBP; GTF2D1; TF2D; TFIID; TATA-box-binding protein; TATA sequence-binding protein; TATA-binding factor; TATA-box factor; Transcription initiation factor TFIID TBP subunit	WB, IHC-F, IHC-P, ICC/IF, IP	Human, Mouse
	TATA Box Binding Protein Antibody (YA3260) is a rabbit-derived non-conjugated IgG antibody (Clone NO.: YA3260), targeting TATA Box Binding Protein, with a predicted molecular weight of 38 kDa (observed band size: 38 kDa). TATA Box Binding Protein Antibody (YA3260) can be used for WB, IHC-F, IHC-P, ICC/IF, IP experiment in human, mouse background.

HY-P81198

	AXL Antibody Adhesion related kinase; AI323647; Ark; Axl; AXL oncogene; AXL receptor tyrosine kinase; AXL transforming gene; AXL transforming sequence/gene; EC 2.7.10.1; JTK11; Oncogene AXL; Tyro7; Tyrosine protein kinase receptor UFO; Tyrosine-protein kinase receptor UFO; UFO; UFO_HUMAN.	WB, ELISA, IHC-P, IHC-F, ICC/IF	Human, Mouse
	AXL Antibody is an unconjugated, approximately 95 kDa, rabbit-derived, anti-AXL polyclonal antibody. AXL Antibody can be used for: WB, ELISA, IHC-P, IHC-F, IF expriments in human, mouse, and predicted: rat, dog, horse, rabbit background without labeling.

HY-P81409

	SATB1 Antibody (YA1154) DNA-binding protein SATB1 (Special AT-rich sequence-binding protein 1)	IHC-P	Human
	SATB1 Antibody (YA1154) is a rabbit-derived non-conjugated IgG antibody (Clone NO.: YA1154), targeting SATB1. SATB1 Antibody (YA1154) can be used for IHC-P experiment in human background.

HY-P85743

	TBP/TATA Binding Protein Antibody (YA5435) TBP; GTF2D1; TF2D; TFIID; TATA-box-binding protein; TATA sequence-binding protein; TATA-binding factor; TATA-box factor; Transcription initiation factor TFIID TBP subunit	WB	Human, Rat, Mouse
	TBP/TATA Binding Protein Antibody (YA5435) is a mouse-derived and non-conjugated monoclonal antibody, targeting to TBP/TATA Binding Protein. It can be applicated for WB assays, in the background of human, rat, mouse.

HY-P86585

	TATA Box Binding Protein Antibody (YA6277) TBP; GTF2D1; TF2D; TFIID; TATA-box-binding protein; TATA sequence-binding protein; TATA-binding factor; TATA-box factor; Transcription initiation factor TFIID TBP subunit	WB, IHC-P, ICC/IF, IP, ELISA	Human, Mouse, Rat
	TATA Box Binding Protein Antibody (YA6277) is a rabbit-derived and non-conjugated IgG monoclonal antibody, targeting to TATA Box Binding Protein. It can be applicated for WB, IHC-P, ICC/IF, IP, ELISA assays, in the background of human, mouse, rat.

HY-P86845

	DCC Antibody (YA6538) Colorectal cancer related chromosome sequence 18 antibody; Colorectal cancer suppressor antibody; CRC 18 antibody; CRC18 antibody; CRCR 1 antibody; CRCR1 antibody; DCC antibody; DCC_HUMAN antibody; Deleted in colorectal cancer protein antibody; Deleted in colorectal carcinoma antibody; Colorectal cancer related chromosome sequence 18 antibody; Colorectal cancer suppressor antibody; CRC 18 antibody; CRC18 antibody; CRCR 1 antibody; CRCR1 antibody; DCC antibody; DCC_HUMAN antibody; Deleted in colorectal cancer protein antibody; Deleted in colorectal carcinoma antibody; Immunoglobulin superfamily DCC subclass member 1 antibody; Netrin receptor DCC antibody; Tumor suppressor protein DCC antibody	WB, IHC-F	Human, Mouse, Rat

HY-P87106

	TIMM22 Antibody (YA6799) Mitochondrial import inner membrane translocase subunit Tim22 antibody; Putative membrane protein antibody; Testis expressed sequence 4 antibody; TEX 4 antibody; TEX4 antibody; TIM 22 antibody; TIM22 antibody; TIMM 22 antibody; Translocase of inner mitochondrial membrane 22 homolog antibody	WB, IHC-P, ICC/IF	Human, Mouse, Rat

HY-P86875

	FAM38A/PIEZO1 Antibody (YA6568) DHS Fam38a Family with sequence similarity 38 member A KIAA0233 Membrane protein induced by beta-amyloid treatment Mib PIEZ1_HUMAN Piezo-type mechanosensitive ion channel component 1 PIEZO1 protein FAM38A DHS Fam38a Family with sequence similarity 38 member A KIAA0233 Membrane protein induced by beta-amyloid treatment Mib PIEZ1_HUMAN Piezo-type mechanosensitive ion channel component 1 PIEZO1 protein FAM38A protein FAM38B protein PIEZO1	WB, IHC-P, ICC/IF	Human, Mouse, Rat

HY-P85936

	pS2 Antibody (YA5628) BCEI; Breast cancer estrogen inducible protein; Breast cancer estrogen inducible sequence; Breast cancer estrogen-inducible protein; D21S21; Gastrointestinal trefoil protein; Gastrointestinal trefoil protein pS2; hP1.A; HP1A; HPS 2; HPS2; pNR 2; PNR-2; pNR2; Polypeptide P1.A; protein pS2; PS 2; pS2; pS2 protein; TFF 1; TFF1; TFF1_HUMAN; Trefoil factor 1	IHC-P, WB, ICC/IF, ELISA	Human
	pS2 Antibody (YA5628) is a mouse-derived and non-conjugated IgG1 monoclonal antibody, targeting to pS2. It can be applicated for IHC-P, WB, ICC/IF, ELISA assays, in the background of human.

HY-P86893

	Gli2 Antibody (YA6586) CJS antibody; Gli 2 antibody; GLI family zinc finger 2 antibody; GLI Kruppel family member GLI2 antibody; GLI2 antibody; GLI2_HUMAN antibody; Glioma associated oncogene family zinc finger antibody; HPE9 antibody; Oncogene GLI2 antibody; PHS2 antibody; CJS antibody; Gli 2 antibody; GLI family zinc finger 2 antibody; GLI Kruppel family member GLI2 antibody; GLI2 antibody; GLI2_HUMAN antibody; Glioma associated oncogene family zinc finger antibody; HPE9 antibody; Oncogene GLI2 antibody; PHS2 antibody; Tax helper protein 1 antibody; Tax helper protein 2 antibody; Tax helper protein antibody; Tax responsive element 2 holding protein antibody; Tax responsive element 25 bp sequence binding protein antibody; THP antibody; THP1 antibody; THP2 antibody; Zinc finger protein GLI2 antibody	WB	Human, Mouse, Rat

HY-P81083

	ADGRE1 (F4/80) Antibody (YA920) F4/80 (mouse); Adhesion G protein-coupled receptor E1; Cell surface glycoprotein EMR1; Cell surface glycoprotein F4/80; DD7A5 7; Egf like module containing mucin like hormone receptor like 1; Egf like module containing mucin like hormone receptor like sequence 1; EGF like module receptor 1; EGF TM7; EGF-like module receptor 1; EGF-like module-containing mucin-like hormone receptor-like 1; EGFTM7; EMR 1; EMR1; EMR-1; EMR1 hormone receptor; EMR1_HUMAN; AGRE1_HUMAN; Gpf480; Ly71; Lymphocyte antigen 71; TM7LN3.	WB, IHC-P, IHC-F, ICC/IF	Mouse, Rat
	ADGRE1 (F4/80) Antibody (YA920) is an unconjugated, approximately 102 kDa, rabbit-derived, anti-ADGRE1 (F4/80) (YA920) monoclonal antibody. ADGRE1 (F4/80) Antibody (YA920) can be used for: WB, IHC-P, IF-Tissue, IHC-Fr expriments in mouse, rat background without labeling.

HY-P86800

	CCDC98 Antibody (YA6493) 3830405G04Rik antibody; 5630400M01Rik antibody; ABRA1 antibody; ABRAXAS antibody; Abraxas protein antibody; AI506069 antibody; AL024423 antibody; AV118690 antibody; BRCA1-A complex subunit Abraxas antibody; coiled coil domain containing 98 antibody; 3830405G04Rik antibody; 5630400M01Rik antibody; ABRA1 antibody; ABRAXAS antibody; Abraxas protein antibody; AI506069 antibody; AL024423 antibody; AV118690 antibody; BRCA1-A complex subunit Abraxas antibody; coiled coil domain containing 98 antibody; Coiled-coil domain-containing protein 98 antibody; F175A_HUMAN antibody; FAM175A antibody; Family with sequence similarity 175 member A antibody; FLJ11520 antibody; FLJ12642 antibody; FLJ13614 antibody; protein FAM175A antibody	WB, ICC/IF, IHC-P, FC	Human

HY-P85601

	BRG1 Antibody (YA5293) ATP dependent helicase SMARCA4; ATP-dependent helicase SMARCA4; BAF 190; BAF190; BAF190A; Brahma protein homolog 1; Brahma protein like 1; BRG1; BRG1 associated factor 190A; BRG1 protein; BRG1-associated factor 190A; BRM/SWI2 related gene 1; Global transcription activator homologous sequence; global transcription activator snf2l4; Homeotic gene regulator; hSNF2b; Mitotic growth and transcription activator; MRD16; Nuclear protein GRB1; protein brahma homolog 1; protein BRG-1; protein BRG1; RTPS2; SMARC A4; SMARCA4; SMCA4_HUMAN; SNF2; SNF2 beta; SNF2 like 4; SNF2-beta; SNF2B; SNF2L4; SNF2LB; Sucrose nonfermenting like 4; SWI/SNF related matrix associated actin dependent regulator of chromatin subfamily A member 4; SWI/SNF related, matrix associated, actin dependent regulator of chromatin, subfamily a, member 4; SWI/SNF-related matrix-associated actin-dependent regulator of chromatin subfamily A member 4; SWI2; Transcription activator BRG1.	WB, ICC/IF, IP	Human, Mouse
	BRG1 Antibody (YA5293) is a mouse-derived and non-conjugated monoclonal antibody, targeting to BRG1. It can be applicated for WB, ICC/IF, IP assays, in the background of human, mouse.