1. Search Result
Search Result
Results for "

messenger

" in MedChemExpress (MCE) Product Catalog:

100

Inhibitors & Agonists

5

Screening Libraries

7

Biochemical Assay Reagents

4

Peptides

25

Natural
Products

8

Isotope-Labeled Compounds

19

Oligonucleotides

Targets Recommended:
Cat. No. Product Name Target Research Areas Chemical Structure
  • HY-147217

    ISIS 505358

    HBV Infection
    Bepirovirsen is an antisense oligonucleotide targeting all HBV messenger RNAs. Bepirovirsen leads to reductions in HBV-derived RNAs, HBV DNA and viral proteins. Bepirovirsen can be used for the research of chronic HBV infection. Bepirovirsen binding site sequence (GCACTTCGCTTCACCTCTGC) .
    Bepirovirsen
  • HY-147217A

    ISIS 505358 sodium

    HBV Infection
    Bepirovirsen (ISIS 505358) sodium is an antisense oligonucleotide targeting all HBV messenger RNAs. Bepirovirsen sodium leads to reductions in HBV-derived RNAs, HBV DNA and viral proteins. Bepirovirsen sodium can be used for the research of chronic HBV infection. Bepirovirsen sodium binding site sequence (GCACTTCGCTTCACCTCTGC) .
    Bepirovirsen sodium
  • HY-B1511
    Cyclic AMP
    10+ Cited Publications

    Cyclic adenosine monophosphate; Adenosine cyclic 3', 5'-monophosphate; cAMP

    Endogenous Metabolite Neurological Disease Metabolic Disease Cancer
    Cyclic AMP (Cyclic adenosine monophosphate), adenosine triphosphate derivative, is an intracellular signaling molecule responsible for directing cellular responses to extracellular signals. Cyclic AMP is an important second messenger in many biological processes .
    Cyclic AMP
  • HY-B1511A
    Cyclic AMP sodium
    10+ Cited Publications

    Cyclic adenosine monophosphate sodium; Adenosine cyclic 3', 5'-monophosphate sodium; cAMP sodium; Cyclic AMP sodium

    Biochemical Assay Reagents Neurological Disease Metabolic Disease Cancer
    Cyclic AMP (Cyclic adenosine monophosphate) sodium, adenosine triphosphate derivative, is an intracellular signaling molecule responsible for directing cellular responses to extracellular signals. Cyclic AMP sodium is an important second messenger in many biological processes .
    Cyclic AMP sodium
  • HY-12512
    cGAMP
    Maximum Cited Publications
    17 Publications Verification

    Cyclic GMP-AMP; 3',3'-cGAMP

    STING Inflammation/Immunology
    cGAMP (Cyclic GMP-AMPP) functions as an endogenous second messenger in metazoans and triggers interferon production in response to cytosolic DNA. cGAMP activates stimulator of interferon genes (STING), which activates a signaling cascade leading to the production of type I interferons and other immune mediators .
    cGAMP
  • HY-110385
    cGAMP disodium
    Maximum Cited Publications
    17 Publications Verification

    Cyclic GMP-AMP disodium; 3',3'-cGAMP disodium

    STING Endogenous Metabolite Inflammation/Immunology
    cGAMP (Cyclic GMP-AMPP) disodium functions as an endogenous second messenger in metazoans and triggers interferon production in response to cytosolic DNA. cGAMP diammonium activates stimulator of interferon genes (STING), which activates a signaling cascade leading to the production of type I interferons and other immune mediators .
    cGAMP disodium
  • HY-110385A
    cGAMP diammonium
    Maximum Cited Publications
    17 Publications Verification

    Cyclic GMP-AMP diammonium; 3',3'-cGAMP diammonium

    STING Endogenous Metabolite Inflammation/Immunology
    cGAMP (Cyclic GMP-AMPP) diammonium functions as an endogenous second messenger in metazoans and triggers interferon production in response to cytosolic DNA. cGAMP diammonium activates stimulator of interferon genes (STING), which activates a signaling cascade leading to the production of type I interferons and other immune mediators .
    cGAMP diammonium
  • HY-B1511R

    Cyclic adenosine monophosphate (Standard); Adenosine cyclic 3', 5'-monophosphate (Standard); cAMP (Standard)

    Endogenous Metabolite Reference Standards Cancer
    Cyclic AMP (Standard) is the analytical standard of Cyclic AMP. Cyclic AMP (Cyclic adenosine monophosphate), adenosine triphosphate derivative, is an intracellular signaling molecule responsible for directing cellular responses to extracellular signals. Cyclic AMP is an important second messenger in many biological processes .
    Cyclic AMP (Standard)
  • HY-151507

    Liposome Others
    306Oi10 is a branched ionizable lipid that can be used to construct lipid nanoparticles (LNPs) for delivering messenger RNA. The surface ionization of lipid nanoparticles is related to the effectiveness of mRNA delivery. The tail of 306Oi10 has a one-carbon branch, which provides it with stronger surface ionization compared to lipids with linear tails, thereby enhancing its mRNA delivery efficacy. 306Oi10 can be used in research related to mRNA delivery .
    306Oi10
  • HY-172570

    Ins(1,2,3,5,6)-P5 tetrasodium; 1,2,3,5,6-IP5 tetrasodium

    Calcium Channel Others
    D-myo-inositol-1,2,3,5-tetraphosphate (Ins(1,2,3,5,6)-P5) tetrasodium is one of the Inositol phosphate isomers and can act as a soluble second messenger to participate in cellular calcium signaling .
    D-myo-Inositol-1,2,3,5-tetraphosphate tetrasodium
  • HY-N7395

    cADPR

    Calcium Channel TRP Channel Endogenous Metabolite Infection Cardiovascular Disease Neurological Disease Inflammation/Immunology Endocrinology
    Cyclic ADP-ribose (cADPR) is a potent second messenger for calcium mobilization that is synthesized from NAD + by an ADP-ribosyl cyclase. Cyclic ADP-ribose increases cytosolic calcium mainly by Ryanodine receptor-mediated release from endoplasmic reticulum and also by extracellular influx through the opening of TRPM2 channels .
    Cyclic ADP-​ribose
  • HY-N7395A

    cADPR ammonium

    Calcium Channel TRP Channel Endogenous Metabolite Infection Cardiovascular Disease Neurological Disease Inflammation/Immunology Endocrinology
    Cyclic ADP-ribose ammonium (cADPR ammonium) is a potent second messenger for calcium mobilization that is synthesized from NAD + by an ADP-ribosyl cyclase. Cyclic ADP-ribose ammonium increases cytosolic calcium mainly by Ryanodine receptor-mediated release from endoplasmic reticulum and also by extracellular influx through the opening of TRPM2 channels .
    Cyclic ADP-​ribose ammonium
  • HY-148965A

    DPPI-3-P ammonium; PIP[3'](16:0/16:0) ammonium; PI(3)P (16:0/16:0) ammonium

    Drug Derivative Reactive Oxygen Species (ROS) Others
    PtdIns-(3)-P1 (1,2-dipalmitoyl) (Compound 7) ammonium is a derivative of phosphatidylinositol 3-phosphate (PtdIns(3)P). phosphatidylinositol 3-phosphate can bind to the FYVE domain of human EEA1 and act as a second messenger in cellular signaling and membrane trafficking. phosphatidylinositol 3-phosphate can stimulate ROS formation by regulating the neutrophil oxidase complex .
    PtdIns-(3)-P1 (1,2-dipalmitoyl) ammonium
  • HY-W010410

    Others Neurological Disease Metabolic Disease
    Oct-1-en-3-ol, a fatty acid fragrant, is a self-stimulating oxylipin messenger. Oct-1-en-3-ol serves as a signaling molecule in plant cellular responses, plant-herbivore interactions, and plant-plant interactions. Oct-1-en-3-ol causes dopamine neuron degeneration through disruption of dopamine handling .
    Oct-1-en-3-ol
  • HY-12895
    SKI V
    1 Publications Verification

    SphK PI3K Apoptosis Cancer
    SKI V is a noncompetitive and potent non-lipid sphingosine kinase (SPHK; SK) inhibitor with an IC50 of 2 μM for GST-hSK. SKI V potently inhibits PI3K with an IC50 of 6 μM for hPI3k. SKI V decreases formation of the mitogenic second messenger sphingosine-1-phosphate (S1P). SKI V induces apoptosis and has antitumor activity .
    SKI V
  • HY-108496
    Sphingosine-1-phosphate
    10+ Cited Publications

    S1P

    Endogenous Metabolite LPL Receptor Inflammation/Immunology Endocrinology Cancer
    Sphingosine-1-phosphate (S1P) is an agonist of S1P1-5 receptors and a ligand of GPR3, GPR6 and GPR12. Sphingosine-1-phosphate is an intracellular second messenger and mobilizes Ca 2+ as an extracellular ligand for G protein-coupled receptors . Sphingosine-1-phosphate is an important lipid mediator generated from Sphingomyelin (HY-113498) or other membrane phospholipids . Sphingosine-1-phosphate stimulates the DNA synthesis, cell proliferation and migration .
    Sphingosine-1-phosphate
  • HY-128468

    Liposome PKC Parasite Others
    1,2-Dimyristoyl-sn-glycerol is a saturated diacylglycerol and a weak second messenger for the activation of PKC .
    1,2-Dimyristoyl-sn-glycerol
  • HY-103317

    Others Inflammation/Immunology
    NAADP, a nucleotide, is a Ca 2+-mobilizing second messenger. NAADP is essential for initiation of Ca 2+ signaling .
    NAADP
  • HY-128465

    Endogenous Metabolite Others
    1,2-Dilauroyl-sn-glycerol is a saturated diacylglycerol and may play a role in second messenger signal transduction .
    1,2-Dilauroyl-sn-glycerol
  • HY-W788583

    Calcium Channel Metabolic Disease
    Inositol 1,3-bisphosphate sodium is one of the many inositol phosphate (InsP) isomers that could act as small, soluble second messengers in the transmission of cellular signals .
    Inositol 1,3-bisphosphate sodium
  • HY-132587A

    ALN-AT3SC sodium; SAR439774 sodium

    Factor Xa Others
    Fitusiran sodium, an small interfering RNA, specifically targets antithrombin (AT) messenger RNA to lower production of AT in the liver. Fitusiran sodium increases thrombin generation and has the potential for the research of the hemophilia .
    Fitusiran sodium
  • HY-174792

    mRNA Others
    The Cre-T2A-GFP mRNA is a capped and polyadenylated messenger RNA encoding a Cre recombinase with a nuclear localization sequence (NLS) and a green fluorescent protein (GFP).
    Cre-T2A-GFP mRNA
  • HY-105279

    PP 56

    FGFR Others
    α-Trinositol (PP 56) is an isomer of the intracellular messenger IP3. α-Trinositol can be used in the study of in vitro cytotoxicity and glutamate-induced glial cytotoxic swelling and injury .
    α-Trinositol
  • HY-132587

    ALN-AT3SC; SAR439774

    Small Interfering RNA (siRNA) Factor Xa Others
    Fitusiran (ALN-AT3SC), an small interfering RNA, specifically targets antithrombin (AT) messenger RNA to lower production of AT in the liver. Fitusiran increases thrombin generation and has the potential for the research of the hemophilia .
    Fitusiran
  • HY-150224

    Small Interfering RNA (siRNA) Factor Xa Others
    GalNAc unconjugated/naked Fitusiran (sodium), an small interfering RNA without GalNAc conjugation, specifically targets antithrombin (AT) messenger RNA to lower production of AT in the liver. Fitusiran increases thrombin generation and has the potential for the research of the hemophilia .
    GalNAc unconjugated/naked Fitusiran sodium
  • HY-112980A
    Nusinersen sodium
    3 Publications Verification

    DNA/RNA Synthesis Neurological Disease
    Nusinersen sodium is an antisense oligonucleotide active molecule. Nusinersen sodium modifies the pre-messenger RNA splicing of the SMN2 gene, thereby promoting the production of full-length SMN protein. Nusinersen sodium improves spinal muscular atrophy .
    Nusinersen sodium
  • HY-103317A

    Calcium Channel Cardiovascular Disease Cancer
    NAADP tetrasodium is a second messenger. NAADP tetrasodium releases Ca 2+ from acidic endosomes and lysosomes. NAADP tetrasodium can be used to study cancer (such as oral squamous cell carcinoma, malignant melanoma) and angiogenesis-related diseases .
    NAADP tetrasodium
  • HY-112980
    Nusinersen
    3 Publications Verification

    DNA/RNA Synthesis Neurological Disease
    Nusinersen is an antisense oligonucleotide active molecule. Nusinersen modifies the pre-messenger RNA splicing of the SMN2 gene, thereby promoting the production of full-length SMN protein. Nusinersen improves spinal muscular atrophy .
    Nusinersen
  • HY-N0086
    N6-Methyladenosine
    5+ Cited Publications

    6-Methyladenosine; N-Methyladenosine

    Influenza Virus Endogenous Metabolite Infection
    N6-Methyladenosine is the most prevalent internal (non-cap) modification present in the messenger RNA (mRNA) of all higher eukaryotes. N6-Methyladenosine can modifies viral RNAs and has antiviral activities.
    N6-Methyladenosine
  • HY-175384

    Ins(3)P1 sodium salt; 3-IP1 sodium

    Endogenous Metabolite Others
    D-myo-Inositol-3-phosphate (sodium) is one of the members in inositol phosphate family of second messengers that play an important role in transmitting cellular signals. D-myo-Inositol-3-phosphate (sodium) can be formed by the dephosphorylation of polyphosphate inositols .
    D-myo-Inositol-3-phosphate sodium
  • HY-153238

    Parasite Infection
    AN15368 is an orally active small-molecule precursor that can be activated by parasite carboxypeptidase to produce a compound that targets the messenger RNA processing pathway in T. cruzi. cruzi. AN15368 has the potential to prevent and research Chagas disease potential .
    AN15368
  • HY-W787880

    Ins(1,2)P2 sodium

    Calcium Channel Metabolic Disease
    D-myo-Inositol-1,2-diphosphate (Ins(1,2)P2) sodium is one of the many inositol phosphate (InsP) isomers that could act as small, soluble second messengers in the transmission of cellular signals .
    D-myo-Inositol-1,2-diphosphate sodium
  • HY-W788039A

    Ins(1,3,5)P3 sodium; 1,3,5-IP3 sodium

    Endogenous Metabolite Others
    D-myo-Inositol-1,3,5-triphosphate (Ins(1,3,5)P3) sodium is a member of the inositol phosphate (InsP) family of second messengers that play a critical role in the transmission of cellular signals .
    D-myo-Inositol-1,3,5-triphosphate sodium
  • HY-175385

    Ins(1)P1 sodium; 1-IP1 sodium salt

    Endogenous Metabolite Others
    D-myo-Inositol-1-phosphate (sodium salt) is one of the members in inositol phosphate family of second messengers that play an important role in transmitting cellular signals. D-myo-Inositol-1-phosphate (sodium salt) can be formed by the dephosphorylation of polyphosphate inositols .
    D-myo-Inositol-1-phosphate sodium salt
  • HY-132609

    Small Interfering RNA (siRNA) Transthyretin (TTR) Neurological Disease
    Patisiran sodium is a double-stranded small interfering RNA that targets a sequence within the transthyretin (TTR) messenger RNA. Patisiran sodium specifically inhibits hepatic synthesis of mutant and wild-type TTR. Patisiran sodium can be used for the research of hereditary TTR amyloidosis .
    Patisiran sodium
  • HY-143700

    Liposome Neurological Disease
    18:0 DAP can be used to formulate lipid nanoparticles (LNPs), which mRNA is encapsulated in their core .
    18:0 DAP
  • HY-141574

    PKC Others
    1,2-Didecanoyl-sn-glycerol is an analog of the PKC-activating second messenger DAG. Although the biological activities of 1,2-didecanoyl-sn-glycerol have not been well characterized, it is expected to behave similarly to 1,2-dioctanoyl-sn-glycerol.
    1,2-Didecanoyl-Sn-glycerol
  • HY-103642A

    Inositol 1,4,5-trisphosphate trisodium; Ins(1,4,5)-P3 trisodium

    Calcium Channel Metabolic Disease
    D-myo-Inositol-1,4,5-triphosphate sodium salt is the trisodium salt of D-myo-Inositol 1,4,5-trisphosphate (1,4,5-IP3), which is a second messenger that stimulates the discharge of calcium from the endoplasmic reticulum.
    D-myo-Inositol-1,4,5-triphosphate trisodium
  • HY-114457

    L-alpha-Phosphatidylinositol-4,5-bisphosphate

    PI3K Others
    Phosphatidylinositol 4,5-bisphosphate (L-alpha-Phosphatidylinositol-4,5-bisphosphate), a phospholipid component of cell membranes, is a substrate for phospholipase C (PLC) and phosphoinositide 3-kinase (PI3K) and as a primary messenger .
    Phosphatidylinositol 4,5-bisphosphate
  • HY-103642

    Inositol 1,4,5-trisphosphate hexapotassium salt; Ins(1,4,5)-P3 hexapotassium salt

    Calcium Channel Metabolic Disease
    D-myo-Inositol 1,4,5-trisphosphate hexapotassium salt is the hexapotassium salt of D-myo-Inositol 1,4,5-trisphosphate (1,4,5-IP3), which is a second messenger that stimulates the discharge of calcium from the endoplasmic reticulum.
    D-myo-Inositol 1,4,5-trisphosphate hexapotassium salt
  • HY-174791

    mRNA Others
    The Cre-T2A-GFP mRNA is a capped and polyadenylated messenger RNA encoding a Cre recombinase with a nuclear localization sequence (NLS) and a green fluorescent protein (GFP). The incorporation of N1-Methylpseudo-UTP can reduce the immunogenicity of the resulting mRNA.
    Cre-T2A-GFP mRNA (N1-Methylpseudo-UTP)
  • HY-137721

    Endonuclease Infection
    Cyclic tri-AMP is a component of the cyclic oligonucleotide-based anti-phage signaling system (CBASS), and acts as the second messenger in the immune response against viral infection. Cyclic tri-AMP binds to and activates DNA endonuclease NucC, results in cell death and exhibits antiviral activity .
    Cyclic tri-AMP
  • HY-128465R

    Endogenous Metabolite Others
    1,2-Dilauroyl-sn-glycerol (Standard) is the analytical standard of 1,2-Dilauroyl-sn-glycerol. This product is intended for research and analytical applications. 1,2-Dilauroyl-sn-glycerol is a saturated diacylglycerol and may play a role in second messenger signal transduction .
    1,2-Dilauroyl-sn-glycerol (Standard)
  • HY-153609

    Transthyretin (TTR) Small Interfering RNA (siRNA) Neurological Disease
    AS-Patisiran sodium is an antisense strand of Patisiran. Patisiran is a double-stranded small interfering RNA that targets a sequence within the transthyretin (TTR) messenger RNA. Patisiran specifically inhibits hepatic synthesis of mutant and wild-type TTR. Patisiran can be used for the research of hereditary TTR amyloidosis .
    AS-Patisiran sodium
  • HY-117115

    Biochemical Assay Reagents Others
    1,2-Dihexanoyl-sn-glycerol is an analog of protein kinase C (PKC) that activates the second messenger diacylglycerol (DAG). Although the biological activity of 1,2-dicaproyl-sn-glycerol has not been well characterized, it is expected to behave similarly to 1,2-dioctanoyl-sn-glycerol.
    1,2-Dihexanoyl-sn-glycerol
  • HY-114208

    Histone Methyltransferase Cancer
    BI-9321, a chemical probe, is a potent, selective and cellular active nuclear receptor-binding SET domain 3 (NSD3)-PWWP1 domain antagonist with a Kd value of 166 nM. BI-9321 is inactive against NSD2-PWWP1 and NSD3-PWWP2. BI-9321 specifically disrupts histone interactions of the NSD3-PWWP1 domain with an IC50 of 1.2 μM in U2OS cells .
    BI-9321
  • HY-114208A

    Histone Methyltransferase Cancer
    BI-9321 trihydrochloride is a potent, selective and cellular active nuclear receptor-binding SET domain 3 (NSD3)-PWWP1 domain antagonist with a Kd value of 166 nM. BI-9321 trihydrochloride is inactive against NSD2-PWWP1 and NSD3-PWWP2. BI-9321 trihydrochloride specifically disrupts histone interactions of the NSD3-PWWP1 domain with an IC50 of 1.2 μM in U2OS cells .
    BI-9321 trihydrochloride
  • HY-126076A

    DNA/RNA Synthesis Cancer
    VPC-80051 is an inhibitor of hnRNP A1 splicing activity. VPC-80051 directly interacts with hnRNP A1 RBD and reduces AR-V7 messenger levels in 22Rv1 CRPC cell line. VPC-80051 can be used in prostate cancer research .
    VPC-80051
  • HY-W011176

    1,2-Dioctanoyl-sn-glycerol

    Endogenous Metabolite Others
    (S)-3-Hydroxypropane-1,2-diyl dioctanoate (1,2-Dioctanoyl-sn-glycerol) is a cell-permeable analog of the PKC-activating second messenger DAG. (S)-3-Hydroxypropane-1,2-diyl dioctanoate induces acrosome reaction in human sperm.
    (S)-3-Hydroxypropane-1,2-diyl dioctanoate
  • HY-101175
    3-Bromo-7-nitroindazole
    1 Publications Verification

    NO Synthase Neurological Disease
    3-Bromo-7-nitroindazole is a more potent and selective inhibitor of neuronal nitric oxide synthase (nNOS) than eNOS or inducible nitric oxide synthase (iNOS). 3-Bromo-7-nitroindazole affects the intercellular messenger nitric oxide (NO) synthesis throughout the body and brain .
    3-Bromo-7-nitroindazole

Inquiry Online

Your information is safe with us. * Required Fields.

Salutation

 

Country or Region *

Applicant Name *

 

Organization Name *

Department *

     

Email Address *

 

Product Name *

Cat. No.

 

Requested quantity *

Phone Number *

     

Remarks

Inquiry Online

Inquiry Information

Product Name:
Cat. No.:
Quantity:
MCE Japan Authorized Agent: