1. Search Result
Search Result
Pathways Recommended: Anti-infection
Results for "

chronic HBV infection

" in MedChemExpress (MCE) Product Catalog:

11

Inhibitors & Agonists

1

Natural
Products

3

Oligonucleotides

Targets Recommended:
Cat. No. Product Name Target Research Areas Chemical Structure
  • HY-147217

    ISIS 505358

    HBV Infection
    Bepirovirsen is an antisense oligonucleotide targeting all HBV messenger RNAs. Bepirovirsen leads to reductions in HBV-derived RNAs, HBV DNA and viral proteins. Bepirovirsen can be used for the research of chronic HBV infection. Bepirovirsen binding site sequence (GCACTTCGCTTCACCTCTGC) .
    Bepirovirsen
  • HY-147217A

    ISIS 505358 sodium

    HBV Infection
    Bepirovirsen (ISIS 505358) sodium is an antisense oligonucleotide targeting all HBV messenger RNAs. Bepirovirsen sodium leads to reductions in HBV-derived RNAs, HBV DNA and viral proteins. Bepirovirsen sodium can be used for the research of chronic HBV infection. Bepirovirsen sodium binding site sequence (GCACTTCGCTTCACCTCTGC) .
    Bepirovirsen sodium
  • HY-B0277A

    ara-AMP; ara-A 5'-monophosphate

    HBV Antibiotic Infection
    Vidarabine phosphate (Ara-AMP), an antiviral agent, inhibits chronic HBV infection . Vidarabine phosphate also against herpes simplex and varicella zoster viruses .
    Vidarabine phosphate
  • HY-176059

    HBV Infection
    HBV-IN-52 is a selective HBV inhibitor. HBV-IN-52 is a Neplanocin A (HY-130430) derivative that demonstrates significant activity against HBV replication with EC50 = 0.96 μM. HBV-IN-52 can inhibit HBsAg secretion (EC50 = 0.82 μM. HBV-IN-52 can be studied in research for chronic hepatitis B (CHB) infections .
    HBV-IN-52
  • HY-N8168

    HBV Infection
    LPRP-Et-97543 is a potent anti-HBV agent. LPRP-Et-97543 reduces Core, S, and preS but not X promoter activities. LPRP-Et-97543 can be used for acute and chronic HBV infections research .
    LPRP-Et-97543
  • HY-B0277AR

    ara-AMP (Standard); ara-A 5'-monophosphate (Standard)

    Reference Standards HBV Antibiotic Infection
    Vidarabine phosphate (Standard) is the analytical standard of Vidarabine phosphate. This product is intended for research and analytical applications. Vidarabine phosphate (Ara-AMP), an antiviral agent, inhibits chronic HBV infection[1][2]. Vidarabine phosphate also against herpes simplex and varicella zoster viruses[3].
    Vidarabine phosphate (Standard)
  • HY-145713A

    HBV-IN-19 TFA

    HBV Infection
    GS-8873 TFA is the TFA salt form of GS-8873 (HY-145713). GS-8873 TFA is an orally active inhibitor for the production of hepatitis B virus (HBV) surface antigen (HBsAg) with an EC50 of 4 nM. GS-8873 TFA exhibits good pharmacokinetic characters in rats and metabolic stability in human hepatocytes. GS-8873 TFA causes neurofunctional deficits in rats and cynomolgus monkeys .
    GS-8873 TFA
  • HY-145713

    HBV-IN-19

    HBV Infection
    GS-8873 is an orally active inhibitor for the production of hepatitis B virus (HBV) surface antigen (HBsAg) with an EC50 of 4 nM. GS-8873 exhibits good pharmacokinetic characters in rats and metabolic stability in human hepatocytes. GS-8873 causes neurofunctional deficits in rats and cynomolgus monkeys .
    GS-8873
  • HY-163124

    HBV Infection
    HBV-IN-43 (compound 5832) is a potent inhibitor of HBV .
    HBV-IN-43
  • HY-151134

    HBV Infection
    HBV-IN-25 is a good potency, orally active novel HBV cccDNA reducer. HBV-IN-25 has anti-HBeAg potency and anti-HBV activity with IC50 values of 0.58 μM and 1.15 μM, respectively. HBV-IN-25 has good aqueous solubility (LYSA>452 μg/mL) and good PK property with no cellular toxicity .
    HBV-IN-25
  • HY-W352344

    HBV Infection
    2'-Deoxy-L-adenosine is an orally active synthon for modified oligodeoxyribonucleotides. 2'-Deoxy-L-adenosine is a potent, specific and selective inhibitor of the replication of hepatitis B virus (HBV) as well as the closely related duck and woodchuck hepatitis viruses (WHV) .
    2'-Deoxy-L-adenosine

Inquiry Online

Your information is safe with us. * Required Fields.

Salutation

 

Country or Region *

Applicant Name *

 

Organization Name *

Department *

     

Email Address *

 

Product Name *

Cat. No.

 

Requested quantity *

Phone Number *

     

Remarks

Inquiry Online

Inquiry Information

Product Name:
Cat. No.:
Quantity:
MCE Japan Authorized Agent: