1. Signaling Pathways
  2. Neuronal Signaling
  3. Tau Protein

Tau Protein

Tau is well established as a microtubule-associated protein in neurons. They have roles primarily in maintaining the stability of microtubules in axons and are abundant in the neurons of the central nervous system (CNS). However, under pathological conditions, aberrant assembly of tau into insoluble aggregates is accompanied by synaptic dysfunction and neural cell death in a range of neurodegenerative disorders, collectively referred to as tauopathies.

Cat. No. Product Name Effect Purity Chemical Structure
  • HY-P99555
    Tomaralimab
    Inhibitor
    Tomaralimab (OPN-305) is a humanized anti-TLR2 IgG4 monoclonal antibody. Tomaralimab inhibits TLR2, MyD88, NLRP3, and reduces pro-inflammatory cytokine (IL-1β, IL-6, IL-8) production. Tomaralimab reduces tau pathology. Tomaralimab improves cognition, atopic dermatitis. Tomaralimab has anticancer effects on pancreatic ductal adenocarcinoma. Tomaralimab is being studied in myelodysplastic syndrome (MDS), atopic dermatitis, pancreatic ductal adenocarcinoma, Alzheimer's disease, and myocardial ischemia/reperfusion injury.
    Tomaralimab
  • HY-132582C
    IONIS-MAPTRx sodium
    Inhibitor
    IONIS-MAPTRx sodium is the first Tau-lowering antisense oligonucleotide (ASO). IONIS-MAPTRx sodium has the potential for the research of Alzheimer Disease.
    IONIS-MAPTRx sodium
  • HY-156586
    Egalognastat
    99.63%
    Egalognastat (ASN90) is a selective, brain-penetrant and orally active O-GlcNAcase (OGA) enzyme inhibitor with an IC50 value of 10.2 nM. Egalognastat increases O-GlcNAcylation of intracellular proteins like tau and α-synuclein, preventing their aggregation and toxicity. Egalognastat does not inhibit hexosaminidase (Hex). Egalognastat can be used for the research of neurodegenerative diseases, such as tauopathies and α-synucleinopathies (e.g., Alzheimer’s disease and Parkinson’s disease).
    Egalognastat
  • HY-N4150
    Quercetagitrin
    Inhibitor 98.34%
    Quercetagitrin (Quercetagetin-7-O-glucoside) is a natural product that can be isolated from the African marigold (Tagetes erecta). Quercetagitrin has anti-inflammatory activity. Quercetagitrin inhibits Tau accumulation. Quercetagitrin can reverse neuroinflammation and cognitive deficits in P301S-Tau transgenic mouse model through inhibiting NF-κB activation. Quercetagitrin is a dual-target inhibitor of PTPN6 (IC50 = 1 μM) and PTPN9 (IC50 = 1.7 μM). Quercetagitrin enhances glucose uptake by mature C2C12 myoblasts. Quercetagitrin can be studied in research for Alzheimer’s disease and type 2 diabetes.
    Quercetagitrin
  • HY-139066
    Punicic acid
    98.0%
    Punicic acid is a bioactive compound of pomegranate seed oil. Punicic acid is an isomer of conjugated α-linolenic acid and ω-5 polyunsaturated fatty acids. Punicic acid has anti-inflammatory and antioxidant activities and can inhibit the expression of inflammatory mediators such as tumor necrosis factor α (TNF-α). Punicic acid can also reduce the formation of β-amyloid deposits and hyperphosphorylation of tau by increasing the expression of GLUT4 protein and inhibiting the overactivation of calpain, and is used to prevent and treat neurodegenerative diseases. In addition, punicic acid also has breast cancer inhibitor properties that depend on lipid peroxidation and PKC pathways.
    Punicic acid
  • HY-P1675A
    Acetyl-PHF6 amide TFA
    99.75%
    Acetyl-PHF6 amide TFA (AcPHF6 TFA) is a tau derived hexapeptide.
    Acetyl-PHF6 amide TFA
  • HY-132582
    IONIS-MAPTRx
    Inhibitor
    IONIS-MAPTRx (BIIB080) is the first Tau-lowering antisense oligonucleotide (ASO). IONIS-MAPTRx has the potential for the research of Alzheimer Disease.
    IONIS-MAPTRx
  • HY-P1707A
    Tau protein (592-597), human TFA
    Tau protein (592-597), human TFA is a peptide fragment of human Tau protein. The dysfunction of Tau protein is involved in neurodegeneration and dementia.
    Tau protein (592-597), human TFA
  • HY-139307
    MG-2119
    99.67%
    MG-2119 is a potent monomeric tau and α-syn aggregation inhibitor. MG-2119 is a potential agent for neurological disorders research.
    MG-2119
  • HY-P99648
    Gosuranemab
    Inhibitor
    Gosuranemab (BMS-986168; IPN007) is a humanised IgG4 anti-tau monoclonal antibody. Gosuranemab neutralizes the extracellular tau protein, inhibiting the spread and aggregation of pathological tau protein. Gosuranemab can be used for the researches of alzheimer’s disease (AD) and progressive supranuclear palsy (PSP).
    Gosuranemab
  • HY-P9995
    Posdinemab
    Inhibitor ≥99.0%
    Posdinemab (JNJ-63733657) is a humanized IgG1/κ monoclonal antibody that selectively targets phosphorylated tau (pT217). Posdinemab specifically binds to the pT217+tau epitope rich in the proline domain, blocks tau protein aggregation and seed propagation, and promotes the clearance of extracellular tau species. Posdinemab reduces the levels of free and total p217+tau in cerebrospinal fluid, thereby inhibiting the pathological propagation of tau protein and the formation of neurofibrillary tangles. Posdinemab can be used for the study of progressive supranuclear palsy syndrome and Alzheimer's disease (AD), especially for prodromal or mild AD disease.
    Posdinemab
  • HY-154851
    GSK-3 inhibitor 3
    Inhibitor 98.72%
    GSK-3 inhibitor 3 is a selective, orally active and brain-penetrant inhibitor of GSK-3, with IC50s of 0.35 nM and 0.25 nM for GSK-3α and GSK-3β, respectively. GSK-3 inhibitor 3 lowers levels of tau protein phosphorylation at S396 in a triple-transgenic mouse Alzheimer’s disease model, with IC50 of 10 nM. GSK-3 inhibitor 3 can be used for neurological disease research.
    GSK-3 inhibitor 3
  • HY-145313
    TTBK1-IN-2
    Inhibitor 99.91%
    TTBK1-IN-2 (compound 29) is a potent Tau-Tubulin kinase (TTBK1) inhibitor with IC50s of 0.24 and 4.22 µM, respectively. TTBK1-IN-2 reveals good brain penetration in vivo and is able to reduce TDP-43 phosphorylation not only in cell cultures but also in the spinal cord of transgenic TDP-43 mice.
    TTBK1-IN-2
  • HY-156585
    CNS-11
    Inhibitor 98.88%
    CNS-11 is a blood-brain barrier permeable tau fibril-degrading compound. CNS-11 reduces α-synuclein. CNS-11 can be used in Alzheimer's and Parkinson's disease research.
    CNS-11
  • HY-P990995
    Etalanetug
    99.857%
    HY-P990995 is an MAPT-targeting IgG1κ type humanized antibody, the recommed isotype control is Human IgG1 kappa, Isotype Control (HY-P99001).
    Etalanetug
  • HY-101183
    THK5351
    98.95%
    THK5351 can be radiolabeled and used as a radiotracer for in vivo imaging of tau pathology in the brain.
    THK5351
  • HY-139142
    Simufilam
    Inhibitor 98.08%
    Simufilam (PTI-125) is an orally active FLNA modulator. Simufilam restores NMDAR signaling and Arc expression. Simufilam inhibits overactive mTOR signaling by restoring the normal conformation of FLNA, improves insulin sensitivity, reduces Aβ42-induced neuroinflammation and tau protein hyperphosphorylation. Simufilam can be used for research of Alzheimer's disease.
    Simufilam
  • HY-19738
    NQTrp
    Inhibitor 98.37%
    NQTrp, an aromatic naphthoquinone-tryptophan hybrid molecule, an inhibitor of the aggregation of the tau protein with generic anti-amyloidogenic effects. NQTrp inhibits the in vitro aggregation of hexapeptide (41GCWMLY46 within the N-terminus of γD-crystallin) as well as full-length γD-crystallin.
    NQTrp
  • HY-141660
    BSc3094
    98.86%
    BSc3094 is a Tau aggregation inhibitor. BSc3094 can be used for the research of Alzheimer's disease (AD).
    BSc3094
  • HY-132582A
    Tau ASO-12 (murine) (sodium)
    Inhibitor
    TauASO-12 (murine) (sodium) is a Tau-lowering antisense oligonucleotide (ASO) for murine use, and it has the potential for the research of Alzheimer Disease. (TauASO-12 sequence – 5′ GCTTTTACTGACCATGCGAG 3′ )
    Tau ASO-12 (murine) (sodium)
Cat. No. Product Name / Synonyms Application Reactivity