2. Signaling Pathways
  3. Neuronal Signaling
  4. Tau Protein

Tau Protein

Tau is well established as a microtubule-associated protein in neurons. They have roles primarily in maintaining the stability of microtubules in axons and are abundant in the neurons of the central nervous system (CNS). However, under pathological conditions, aberrant assembly of tau into insoluble aggregates is accompanied by synaptic dysfunction and neural cell death in a range of neurodegenerative disorders, collectively referred to as tauopathies.

Cat. No. Product Name Effect Purity Chemical Structure
  • HY-132582C
    IONIS-MAPTRx sodium
    		Inhibitor
    IONIS-MAPTRx sodium is the first Tau-lowering antisense oligonucleotide (ASO). IONIS-MAPTRx sodium has the potential for the research of Alzheimer Disease.
    IONIS-MAPTRx sodium
  • HY-P99555
    Tomaralimab
    		Inhibitor
    Tomaralimab (OPN-305) is a humanized anti-TLR2 IgG4 monoclonal antibody. Tomaralimab inhibits TLR2, MyD88, NLRP3, and reduces pro-inflammatory cytokine (IL-1β, IL-6, IL-8) production. Tomaralimab reduces tau pathology. Tomaralimab improves cognition, atopic dermatitis. Tomaralimab has anticancer effects on pancreatic ductal adenocarcinoma. Tomaralimab is being studied in myelodysplastic syndrome (MDS), atopic dermatitis, pancreatic ductal adenocarcinoma, Alzheimer's disease, and myocardial ischemia/reperfusion injury.
    Tomaralimab
  • HY-114616
    PBB3
    PBB3 is a tracer of tau PET. PBB3 can be used to detect levels of tau protein in Alzheimer's disease and non-Alzheimer's disease.
    PBB3
  • HY-154851
    GSK-3 inhibitor 3
    		Inhibitor 98.72%
    GSK-3 inhibitor 3 is a selective, orally active and brain-penetrant inhibitor of GSK-3, with IC50s of 0.35 nM and 0.25 nM for GSK-3α and GSK-3β, respectively. GSK-3 inhibitor 3 lowers levels of tau protein phosphorylation at S396 in a triple-transgenic mouse Alzheimer’s disease model, with IC50 of 10 nM. GSK-3 inhibitor 3 can be used for neurological disease research.
    GSK-3 inhibitor 3
  • HY-P1675A
    Acetyl-PHF6 amide TFA
    Acetyl-PHF6 amide TFA (AcPHF6 TFA) is a tau derived hexapeptide.
    Acetyl-PHF6 amide TFA
  • HY-101183
    THK5351
    		98.95%
    THK5351 can be radiolabeled and used as a radiotracer for in vivo imaging of tau pathology in the brain.
    THK5351
  • HY-156585
    CNS-11
    		Inhibitor 98.88%
    CNS-11 is a blood-brain barrier permeable tau fibril-degrading compound. CNS-11 reduces α-synuclein. CNS-11 can be used in Alzheimer's and Parkinson's disease research.
    CNS-11
  • HY-132582
    IONIS-MAPTRx
    		Inhibitor
    IONIS-MAPTRx (BIIB080) is the first Tau-lowering antisense oligonucleotide (ASO). IONIS-MAPTRx has the potential for the research of Alzheimer Disease.
    IONIS-MAPTRx
  • HY-145313
    TTBK1-IN-2
    		Inhibitor 99.91%
    TTBK1-IN-2 (compound 29) is a potent Tau-Tubulin kinase (TTBK1) inhibitor with IC50s of 0.24 and 4.22 µM, respectively. TTBK1-IN-2 reveals good brain penetration in vivo and is able to reduce TDP-43 phosphorylation not only in cell cultures but also in the spinal cord of transgenic TDP-43 mice.
    TTBK1-IN-2
  • HY-P1707A
    Tau protein (592-597), human TFA
    		99.20%
    Tau protein (592-597), human TFA is a peptide fragment of human Tau protein. The dysfunction of Tau protein is involved in neurodegeneration and dementia.
    Tau protein (592-597), human TFA
  • HY-139307
    MG-2119
    		99.67%
    MG-2119 is a potent monomeric tau and α-syn aggregation inhibitor. MG-2119 is a potential agent for neurological disorders research.
    MG-2119
  • HY-P99648
    Gosuranemab
    		Inhibitor
    Gosuranemab (BMS-986168) is a humanised IgG4 anti-tau monoclonal antibody. Gosuranemab binds to human N-terminal tau residues 15-22. Gosuranemab has the potential for the research of alzheimer’s disease (AD).
    Gosuranemab
  • HY-19738
    NQTrp
    		Inhibitor 98.37%
    NQTrp, an aromatic naphthoquinone-tryptophan hybrid molecule, an inhibitor of the aggregation of the tau protein with generic anti-amyloidogenic effects. NQTrp inhibits the in vitro aggregation of hexapeptide (41GCWMLY46 within the N-terminus of γD-crystallin) as well as full-length γD-crystallin.
    NQTrp
  • HY-139142
    Simufilam
    		Inhibitor 98.08%
    Simufilam (PTI-125) is an orally active FLNA modulator. Simufilam restores NMDAR signaling and Arc expression. Simufilam inhibits overactive mTOR signaling by restoring the normal conformation of FLNA, improves insulin sensitivity, reduces Aβ42-induced neuroinflammation and tau protein hyperphosphorylation. Simufilam can be used for research of Alzheimer's disease.
    Simufilam
  • HY-132582A
    Tau ASO-12 (murine) (sodium)
    		Inhibitor
    TauASO-12 (murine) (sodium) is a Tau-lowering antisense oligonucleotide (ASO) for murine use, and it has the potential for the research of Alzheimer Disease. (TauASO-12 sequence – 5′ GCTTTTACTGACCATGCGAG 3′ )
    Tau ASO-12 (murine) (sodium)
  • HY-141660
    BSc3094
    		98.86%
    BSc3094 is a Tau aggregation inhibitor. BSc3094 can be used for the research of Alzheimer's disease (AD).
    BSc3094
  • HY-P9995
    Posdinemab
    		Inhibitor ≥99.0%
    Posdinemab (JNJ-63733657) is a humanized IgG1/κ monoclonal antibody that selectively targets phosphorylated tau (pT217). Posdinemab specifically binds to the pT217+tau epitope rich in the proline domain, blocks tau protein aggregation and seed propagation, and promotes the clearance of extracellular tau species. Posdinemab reduces the levels of free and total p217+tau in cerebrospinal fluid, thereby inhibiting the pathological propagation of tau protein and the formation of neurofibrillary tangles. Posdinemab can be used for the study of progressive supranuclear palsy syndrome and Alzheimer's disease (AD), especially for prodromal or mild AD disease.
    Posdinemab
  • HY-10863S
    Anandamide-d8
    		Inhibitor 99.90%
    Anandamide-d8 is a deuterated labeled Anandamide. Anandamide is an endocannabinoid. Anandamide modulates both neuronal and immune functions through two protein-coupled cannabinoid receptors (CB1 and CB2). Anandamide can activate numerous other receptors like PPARS, TRPV1, and GPR18/GPR55. Anandamide also has potential anti-fungal and anti-inflammatory activities. Anandamide can be used for the research of Alzheimer’s disease (AD) and ulcerative colitis.
    Anandamide-d<sub>8</sub>
  • HY-101183A
    THK5351 (R enantiomer)
    THK5351 R enantiomer is an R enantiomer of THK5351.
    THK5351 (R enantiomer)
  • HY-P2516
    Tau Peptide (275-305) (Repeat 2 domain)
    		98.83%
    Tau Peptide (275-305) (Repeat 2 domain) is the Alzheimer's tau fragment R2, corresponding to the second repeat unit of the microtubule-binding domain, which is believed to be pivotal to the biochemical properties of full tau protein.
    Tau Peptide (275-305) (Repeat 2 domain)
Cat. No. Product Name / Synonyms Application Reactivity