2. Signaling Pathways
  3. Anti-infection
  4. HBV

HBV

Hepatitis B virus

HBV

Related Products

PDF 0.42 MB

HBV (Hepatitis B virus), abbreviated HBV, is a species of the genus Orthohepadnavirus, which is likewise a part of the Hepadnaviridae family of viruses. HBV causes the disease hepatitis B. The hepatitis B virus is classified as the type species of the Orthohepadnavirus, which contains three other species: the Ground squirrel hepatitis virus, Woodchuck hepatitis virus, and theWoolly monkey hepatitis B virus. The genus is classified as part of the Hepadnaviridae family. HBV is divided into four major serotypes (adr, adw, ayr, ayw) based on antigenic epitopes present on its envelope proteins, and into eight genotypes (A–H) according to overall nucleotide sequence variation of the genome. The genotypes have a distinct geographical distribution and are used in tracing the evolution and transmission of the virus. Differences between genotypes affect the disease severity, course and likelihood of complications, and response to treatment and possibly vaccination.

Cat. No. Product Name Effect Purity Chemical Structure
  • HY-147217
    Bepirovirsen
    		Inhibitor 98.44%
    Bepirovirsen is an antisense oligonucleotide targeting all HBV messenger RNAs. Bepirovirsen leads to reductions in HBV-derived RNAs, HBV DNA and viral proteins. Bepirovirsen can be used for the research of chronic HBV infection. Bepirovirsen binding site sequence (GCACTTCGCTTCACCTCTGC).
    Bepirovirsen
  • HY-124614
    GLP-26
    		Inhibitor 98.36%
    GLP-26 is a HBV capsid assembly modulators (CAM), inhibits HBV DNA replication in Hep AD38 system (IC50=3 nM), and reduces cccDNA by >90% at 1 μM. GLP-26 disrupts the encapsidation of pre-genomic RNA, causes nucleocapsid disassembly and reduces cccDNA pools. GLP-26 is a click chemistry reagent, it contains an Alkyne group and can undergo copper-catalyzed azide-alkyne cycloaddition (CuAAc) with molecules containing Azide groups.
    GLP-26
  • HY-P1774
    Hepatitis B Virus Core (128-140)
    		99.56%
    Hepatitis B Virus Core (128-140) is a peptide of hepatitis B virus core protein.
    Hepatitis B Virus Core (128-140)
  • HY-N3239
    Mulberrofuran G
    		Inhibitor 99.84%
    Mulberrofuran G is a NOX inhibitor (IC50: 6.9 μM) and tyrosinase inhibitor. Mulberrofuran G exhibits anti-inflammatory, antioxidant, antiviral, antitumor, and neuroprotective effects. Mulberrofuran G can be used in the research of tumors, nervous system diseases, and other conditions.
    Mulberrofuran G
  • HY-W074930
    (S)-Tenofovir
    		Inhibitor 98.34%
    (S)-Tenofovir ((S)-GS 1278) is the less active S-enantiomer of Tenofovir. Tenofovir is a nucleotide reverse transcriptase inhibitor to treat HIV and chronic Hepatitis B (HBV).
    (S)-Tenofovir
  • HY-148560B
    cis-ccc_R08
    		Inhibitor 99.61%
    cis-ccc_R08 (compound 1) is a flavonoid derivative that can be used in the study of hepatitis B virus (HBV) infection. cis-ccc_R08 is a cccDNA (covalently closed circular DNA) inhibitor.
    cis-ccc_R08
  • HY-133721
    Chamaechromone
    		Inhibitor 99.75%
    Chamaechromone is a biflavonoid ingredient isolated from the roots of Stellera chamaejasme L. (Thymelaeaceae). Chamaechromone possesses anti-hepatitis B virus (HBV) effects against the surface antigen of HBV (HBsAg) secretion and has insecticidal activities.
    Chamaechromone
  • HY-149048
    Adenosylhomocysteinase
    Adenosylhomocysteinase (SAHH; AHCY) is a highly conserved enzyme. Adenosylhomocysteinase reversible catalyzes S-adenosylhomocysteine (SAH) to adenosine and L-homocysteine. The serum exosomal Adenosylhomocysteinase level can be used as a prognostic biomarker in HBV-LC patients.
    Adenosylhomocysteinase
  • HY-116364B
    AZT triphosphate tetraammonium
    		Inhibitor 99.45%
    AZT triphosphate (3'-Azido-3'-deoxythymidine-5'-triphosphate) tetraammonium is an active triphosphate metabolite of Zidovudine (AZT). AZT triphosphate tetraammonium exhibits antiretroviral activity and inhibits replication of HIV. AZT triphosphate tetraammonium also inhibits the DNA polymerase of HBV. AZT triphosphate tetraammonium activates the mitochondria-mediated apoptosis pathway.
    AZT triphosphate tetraammonium
  • HY-153797
    Dox-btn2
    		Activator
    Dox-btn2 is a biotin labeled Doxorubicin (HY-15142A), with a biotin label at the point of conjugation to doxorubicin at 3'-NH2. Dox-btn2 can be used for cell imaging. While Doxorubicin is mainly accumulated in the nucleus, while Dox-btn2 is mainly located in the cytoplasm.
    Dox-btn2
  • HY-N0854
    Alisol F
    		Inhibitor 99.89%
    Alisol F is a triterpene isolated from Alisma orinentale, has immunosuppressive and anti-virus functions. Alisol F exhibits inhibitory activity in vitro on hepatitis B virus (HBV) surface antigen (HBsAg) secretion of the HepG2.2.15 cell line with an IC50 of 0.6 μM.
    Alisol F
  • HY-145579
    Linvencorvir
    		Inhibitor 98.14%
    Linvencorvir (RG7907) is an orally active Hepatitis B virus core protein allosteric modulator. Linvencorvir induces Apoptosis. Linvencorvir has antiviral activity against HBV.
    Linvencorvir
  • HY-19447
    Besifovir
    		Inhibitor ≥98.0%
    Besifovir (LB80331), a parent agent converted by LB80380 (HY-19447A), further metabolizes to its active form, LB80317 (HY-106235). Besifovir is an orally active, novel antiviral agent against hepatitis B virus (HBV).
    Besifovir
  • HY-101954A
    Inarigivir ammonium
    		Inhibitor 99.04%
    Inarigivir (ORI-9020) ammonium is a dinucleotide antiviral drug that can significantly reduce liver HBV DNA in transgenic mice expressing hepatitis B virus. Inarigivir (ORI-9020) ammonium acts as a RIG-I (Retinoic acid-inducible gene-I) agonist to activate cellular innate immune responses.
    Inarigivir ammonium
  • HY-P99693
    Lenvervimab
    		Inhibitor ≥99%
    Lenvervimab (GC1102) is a IgG1-type recombinant human hepatitis B Immunoglobulin. Lenvervimab can be used for research of hepatitis B virus infection.
    Lenvervimab
  • HY-113904S
    (Rac)-Tenofovir-d6
    		Inhibitor 99.82%
    (Rac)-Tenofovir-d6 is a labelled racemic Tenofovir. Tenofovir (GS 1278) is a nucleotide reverse transcriptase inhibitor to treat HIV and chronic Hepatitis B (HBV).
    (Rac)-Tenofovir-d<sub>6</sub>
  • HY-109014
    Tenofovir exalidex
    		Inhibitor 99.82%
    Tenofovir exalidex (CMX157) is a lipid conjugate of the acyclic nucleotide analog Tenofovir with activity against both wild-type and antiretroviral drug-resistant HIV strains, including multidrug nucleoside/nucleotide analog-resistant viruses. Tenofovir exalidex is active against all major subtypes of HIV-1 and HIV-2 in fresh human PBMCs and against all HIV-1 strains evaluated in monocyte-derived macrophages, with EC50s ranging between 0.2 and 7.2 nM. CMX157 is orally available and has no apparent toxicity. Tenofovir exalidex also shows antiviral activity against HBV.
    Tenofovir exalidex
  • HY-109195
    Vebicorvir
    		Inhibitor 99.73%
    Vebicorvir (ABI-H0731) is a first-generation hepatitis B virus (HBV) core protein inhibitor. Vebicorvir (ABI-H0731) suppresses covalently closed circular DNA (cccDNA) formation in two de novo infection models with EC50s from 1.84 μM to 7.3 μM.
    Vebicorvir
  • HY-148348
    AB-836
    		Inhibitor 99.13%
    AB-836 is an orally active HBV capsid inhibitor. AB-836 inhibits viral replication by interacting with HBV core protein.
    AB-836
  • HY-P99608
    Exbivirumab
    		Inhibitor
    Exbivirumab is an anti-HBV mAb. Exbivirumab enhances the antiviral activity of hepatitis B immunoglobulin (HBIG).
    Exbivirumab
Cat. No. Product Name / Synonyms Application Reactivity