1. Signaling Pathways
  2. Anti-infection
  3. HBV

HBV

Hepatitis B virus

HBV (Hepatitis B virus), abbreviated HBV, is a species of the genus Orthohepadnavirus, which is likewise a part of the Hepadnaviridae family of viruses. HBV causes the disease hepatitis B. The hepatitis B virus is classified as the type species of the Orthohepadnavirus, which contains three other species: the Ground squirrel hepatitis virus, Woodchuck hepatitis virus, and theWoolly monkey hepatitis B virus. The genus is classified as part of the Hepadnaviridae family. HBV is divided into four major serotypes (adr, adw, ayr, ayw) based on antigenic epitopes present on its envelope proteins, and into eight genotypes (A–H) according to overall nucleotide sequence variation of the genome. The genotypes have a distinct geographical distribution and are used in tracing the evolution and transmission of the virus. Differences between genotypes affect the disease severity, course and likelihood of complications, and response to treatment and possibly vaccination.

Cat. No. Product Name Effect Purity Chemical Structure
  • HY-16468
    Squalamine
    Inhibitor 99.54%
    Squalamine (MSI-1256) is an aminosterol compound with broad-spectrum antiviral activity. Squalamine makes cells less conducive to certain viral replication by altering the electrostatic interactions in the inner membrane of host cells. Squalamine also has antibacterial and antitumor activities. Squalamine has broad-spectrum antibacterial activity against Gram-negative and Gram-positive bacteria, fungi and protozoa. Squalamine inhibits tumor-related angiogenesis and the growth of human breast cancer cells. Squalamine restores the function of enteric nervous system in Parkinson,s disease mouse models.
    Squalamine
  • HY-Y0073
    4-Hydroxyacetophenone
    Inhibitor 99.99%
    4-Hydroxyacetophenone (P-hydroxyacetophenone) is a major hepatoprotective and choleretic compound found in Artemisia and Illicium plants, exhibiting antiviral and anti-inflammatory effects against hepatitis B virus. Additionally, 4-Hydroxyacetophenone inhibits cancer cell adhesion, invasion, and migration by remodeling actin. 4-Hydroxyacetophenone holds promise for research in the fields of inflammatory diseases and cancer.
    4-Hydroxyacetophenone
  • HY-19314A
    Azvudine hydrochloride
    Inhibitor
    Azvudine (RO-0622) hydrochloride is a potent nucleoside reverse transcriptase inhibitor (NRTI), with antiviral activity on HIV, HBV and HCV. Azvudine hydrochloride exerts highly potent inhibition on HIV-1 (EC50s ranging from 0.03 to 6.92 nM) and HIV-2 (EC50s ranging from 0.018 to 0.025 nM). Azvudine hydrochloride inhibits NRTI-resistant viral strains. Azvudine (hydrochloride) is a click chemistry reagent, it contains an Azide group and can undergo copper-catalyzed azide-alkyne cycloaddition reaction (CuAAc) with molecules containing Alkyne groups. It can also undergo strain-promoted alkyne-azide cycloaddition (SPAAC) reactions with molecules containing DBCO or BCN groups.
    Azvudine hydrochloride
  • HY-109168
    Bersacapavir
    Inhibitor 99.24%
    Bersacapavir (JNJ-6379) is a novel Hepatitis B Virus capsid assembly modulator. Bersacapavir interferes with the assembly process of the hepatitis B virus nucleocapsid by binding to the hydrophobic pocket at the dimer-dimer interface of hepatitis B core protein (HBc) subunits. Bersacapavir inhibits the replication of HBV. Bersacapavir is mainly used in the research of chronic hepatitis B.
    Bersacapavir
  • HY-B0955
    Oxethazaine
    Inhibitor 99.94%
    Oxethazaine (Oxetacaine), a precursor of phentermine?acidic, is an acid-resistent and orally active analgesic agent. Oxethazaine (Oxetacaine) has the potential for the relief of pain associated with?peptic ulcer disease?or?esophagitis.
    Oxethazaine
  • HY-N2189
    Swertisin
    Inhibitor 99.75%
    Swertisin is an oral adenosine A1 receptor antagonist and an SGLT2 inhibitor. Swertisin has anti-diabetic, antioxidant properties, inhibits HBV, and improves cognitive and memory impairments in mice.
    Swertisin
  • HY-138407
    Evixapodlin
    Inhibitor 98.14%
    Evixapodlin (GS-4224) is a human PD-1/PD-L1 protein/protein interaction inhibitor with an IC50 of 0.213 nM. Evixapodlin has anticancer and antiviral functions.
    Evixapodlin
  • HY-17426
    Famciclovir
    Inhibitor 99.69%
    Famciclovir (BRL 42810) is an orally active nucleoside analogue. Famciclovir is an antiviral agent with potent activities against HBV, HSV and VZV. Famciclovir can be used for the research of herpesvirus infection.
    Famciclovir
  • HY-131596B
    Emtricitabine triphosphate tetrasodium salt
    Inhibitor 99.06%
    Emtricitabine triphosphate tetrasodium salt is the tetrasodium salt form of Emtricitabine triphosphate (HY-131596). However,Emtricitabine triphosphate ((-)-Emtricitabine triphosphate) is the phosphorylated anabolite of Emtricitabine (HY-17427),a nucleoside reverse transcriptase inhibitor,targeting to HIV and HBV.
    Emtricitabine triphosphate tetrasodium salt
  • HY-147255
    Canocapavir
    Inhibitor 98.40%
    Canocapavir (ZM-H1505R) has orally antiviral activity. Canocapavir is a HBV capsid inhibitor that can be used in the research of Chronic hepatitis B. .
    Canocapavir
  • HY-100029
    Bay 41-4109
    Inhibitor 99.24%
    BAY 41-4109 is a potent inhibitor of human hepatitis B virus (HBV) with an IC50 of 53 nM.
    Bay 41-4109
  • HY-13859
    Clevudine
    Inhibitor 99.93%
    Clevudine (L-FMAU), a nucleoside analog of the unnatural L-configuration, has potent anti-HBV activity with long half-life, low toxicity. Clevudine is a non-competitive inhibitor that is not incorporated into the viral DNA but rather binds to the polymerase. Clevudine is active against cowpox virus respiratory infection in mice.
    Clevudine
  • HY-109035
    Inarigivir soproxil
    Inhibitor 99.87%
    Inarigivir soproxil (SB9200) is an agonist of innate immunity and shows potent antiviral activity against resistant HCV variants, with EC50s of 2.2 and 1.0 μM for HCV 1a/1b in cells of genotype 1 HCV replicon systems. Inarigivir soproxil, an orally bioavailable proagent of SB 9000, has broad-spectrum antiviral activity against RNA viruses including HCV, norovirus, respiratory syncytial virus and influenza and HBV.
    Inarigivir soproxil
  • HY-147217
    Bepirovirsen
    Inhibitor 98.44%
    Bepirovirsen is an antisense oligonucleotide targeting all HBV messenger RNAs. Bepirovirsen leads to reductions in HBV-derived RNAs, HBV DNA and viral proteins. Bepirovirsen can be used for the research of chronic HBV infection. Bepirovirsen binding site sequence (GCACTTCGCTTCACCTCTGC).
    Bepirovirsen
  • HY-147266
    Elebsiran sodium
    Inhibitor
    Elebsiran sodium is a siRNA against hepatitis B and D virus infections .
    Elebsiran sodium
  • HY-10545A
    Taribavirin hydrochloride
    Inhibitor 99.96%
    Taribavirin hydrochloride is an orally active inosine monophosphate dehydrogenase inhibitor, has activity against a wide range of viruses, especially the hepatitis C virus and influenza virus. Taribavirin hydrochloride is a Ribavirin proagent, is designed to concentrate within the liver to target HCV-infected hepatocytes while minimizing distribution within red blood cells (RBCs) and the development of hemolytic anemia.
    Taribavirin hydrochloride
  • HY-124600
    NVR 3-778
    Inhibitor 99.88%
    NVR 3-778 is a first-in-Class and oral bioavailable HBV CAM (capsid assembly modulator) belonging to the SBA (sulfamoylbenzamide) class, with anti-HBV activity.
    NVR 3-778
  • HY-124614
    GLP-26
    Inhibitor 98.36%
    GLP-26 is a HBV capsid assembly modulators (CAM), inhibits HBV DNA replication in Hep AD38 system (IC50=3 nM), and reduces cccDNA by >90% at 1 μM. GLP-26 disrupts the encapsidation of pre-genomic RNA, causes nucleocapsid disassembly and reduces cccDNA pools. GLP-26 is a click chemistry reagent, it contains an Alkyne group and can undergo copper-catalyzed azide-alkyne cycloaddition (CuAAc) with molecules containing Azide groups.
    GLP-26
  • HY-148560A
    trans-ccc_R08
    Inhibitor 99.71%
    trans-ccc_R08 (compound 1-B) is a potent cccDNA (covalently closed circular DMA) inhibitor. trans-ccc_R08 inhibits HBeAg level with an IC50 value of 0.08 µM. trans-ccc_R08 has the potential for the research of Hepatitis B Virus infection (HBV).
    trans-ccc_R08
  • HY-109197
    Vonafexor
    Inhibitor 99.32%
    Vonafexor (EYP001) is an orally active, non-steroidal and selective FXR agonist. Vonafexor shows significant HBsAg reduction when combined with Peg-IFNα. Vonafexor can be used for anti-HBV research.
    Vonafexor
Cat. No. Product Name / Synonyms Application Reactivity