1. Search Result
Search Result
Pathways Recommended: Anti-infection
Results for "

HBV infection

" in MedChemExpress (MCE) Product Catalog:

54

Inhibitors & Agonists

1

Screening Libraries

2

Peptides

2

Natural
Products

1

Isotope-Labeled Compounds

5

Oligonucleotides

Targets Recommended:
Cat. No. Product Name Target Research Areas Chemical Structure
  • HY-147217

    ISIS 505358

    HBV Infection
    Bepirovirsen is an antisense oligonucleotide targeting all HBV messenger RNAs. Bepirovirsen leads to reductions in HBV-derived RNAs, HBV DNA and viral proteins. Bepirovirsen can be used for the research of chronic HBV infection. Bepirovirsen binding site sequence (GCACTTCGCTTCACCTCTGC) .
    Bepirovirsen
  • HY-147217A

    ISIS 505358 sodium

    HBV Infection
    Bepirovirsen (ISIS 505358) sodium is an antisense oligonucleotide targeting all HBV messenger RNAs. Bepirovirsen sodium leads to reductions in HBV-derived RNAs, HBV DNA and viral proteins. Bepirovirsen sodium can be used for the research of chronic HBV infection. Bepirovirsen sodium binding site sequence (GCACTTCGCTTCACCTCTGC) .
    Bepirovirsen sodium
  • HY-P3465
    Bulevirtide
    3 Publications Verification

    Myrcludex B

    HBV Infection
    Bulevirtide (Myrcludex B) is a NTCP inhibitor, a linear lipopeptide of 47 amino acids. Bulevirtide inhibits HBV and HDV entry into liver cells, blocks HBV infection in hepatocytes, and participates in HBV transcriptional suppression. Bulevirtide can be used in HDV infection and compensated cirrhosis research .
    Bulevirtide
  • HY-169125

    HBV Infection
    HBV-IN-49 is an anti-hepatitis B virus (HBV) agent that inhibits HBV replication. HBV-IN-49 can be utilized in infection research .
    HBV-IN-49
  • HY-W676876

    HBV Infection
    Oxynitidine is an HBV inhibitor (ID50=30.8 µg/mL), which can effectively inhibit the DNA replication activity of HBV. Oxynitidine can be used in the study of viral infections .
    Oxynitidine
  • HY-172835

    JH-B10

    HBV Infection
    Rapavir (JH-B10) is a selective and potent sodium taurocholate cotransporting polypeptide (NTCP) inhibitor with an IC50 value of 1.8 nM for the uptake of taurocholic acid-d4 (TCA-d4). Rapavir exerts antiviral activity by directly binding to NTCP and blocking the entry of the virus into cells during the HBV infection phase. Rapavir is promising for research of HBV infections .
    Rapavir
  • HY-131596

    (-)-Emtricitabine triphosphate

    HIV Infection
    Emtricitabine triphosphate ((-)-Emtricitabine triphosphate) is the phosphorylated anabolite of Emtricitabine (HY-17427). Emtricitabine is a nucleoside reverse transcriptase inhibitor. Emtricitabine is antiretroviral agent for HIV and HBV infection .
    Emtricitabine triphosphate
  • HY-N8168

    HBV Infection
    LPRP-Et-97543 is a potent anti-HBV agent. LPRP-Et-97543 reduces Core, S, and preS but not X promoter activities. LPRP-Et-97543 can be used for acute and chronic HBV infections research .
    LPRP-Et-97543
  • HY-144047

    HBV DNA/RNA Synthesis Infection
    HBV-IN-16 is a potent inhibitor of covalently closed circular DNA (cccDNA). cccDNA serves as the template for viral RNA transcription and subsequent viral DNA generation. HBV-IN-16 is a quinoline derivative. HBV-IN-16 has the potential for the research of HBV infection (extracted from patent WO2019121357A1, compound 1) .
    HBV-IN-16
  • HY-144046

    HBV DNA/RNA Synthesis Infection
    HBV-IN-15 is a potent inhibitor of covalently closed circular DNA (cccDNA). cccDNA serves as the template for viral RNA transcription and subsequent viral DNA generation. HBV-IN-15 is a flavone derivative. HBV-IN-16 has the potential for the research of HBV infection (extracted from patent WO2020052774A1, compound 2) .
    HBV-IN-15
  • HY-144045

    HBV DNA/RNA Synthesis Infection
    HBV-IN-14 is a potent inhibitor of covalently closed circular DNA (cccDNA). cccDNA serves as the template for viral RNA transcription and subsequent viral DNA generation. HBV-IN-14 is a pyridinopyrimidinones compound. HBV-IN-14 has the potential for the research of HBV infection (extracted from patent WO2021190502A1, compound 5) .
    HBV-IN-14
  • HY-168045

    HBV DNA/RNA Synthesis Infection
    HBV-IN-48 is an HBV inhibitor. HBV-IN-48 has antiviral activity against HBV in HepDE19 cells, with an EC50 value of 0.005 μM. HBV-IN-48 can reduce serum HBV DNA levels in mouse models of HBV infection .
    HBV-IN-48
  • HY-156702

    HBV Infection
    HBV-IN-38 (Example 193) is an HBV DNA inhibitor (EC50≤100nM). HBV-IN-38 can be used to study viral infections .
    HBV-IN-38
  • HY-176059

    HBV Infection
    HBV-IN-52 is a selective HBV inhibitor. HBV-IN-52 is a Neplanocin A (HY-130430) derivative that demonstrates significant activity against HBV replication with EC50 = 0.96 μM. HBV-IN-52 can inhibit HBsAg secretion (EC50 = 0.82 μM. HBV-IN-52 can be studied in research for chronic hepatitis B (CHB) infections .
    HBV-IN-52
  • HY-169993

    HBV Infection
    ALG-000184, a prodrug of the potent Hhepatitis B virus (HBV) capsid assembly modulator ALG-001075, has the potential for the research of HBV infection research .
    ALG-000184
  • HY-159987

    HBV Infection
    AB-161 is an orally active HBV RNA destabilizer and a PAPD5/7 inhibitor, with its primary action focused in the liver. AB-161 treats Hepatitis B Virus (HBV) infection by lowering the levels of Hepatitis B surface antigen (HBsAg), with an EC50 value of 2.2 nM for HBsAg. AB-161 can be used in the field of HBV infection research .
    AB-161
  • HY-148780

    HBV Infection
    HBV-IN-29 (ex8), a flavone derivative, is a potent covalently closed circular DNA (cccDNA) inhibitor. cccDNA serves as the template for viral RNA transcription and subsequent viral DNA generation. HBV-IN-29 has the potential for the research of HBV infection .
    HBV-IN-29
  • HY-148781

    HBV Infection
    HBV-IN-30 (ex44), a flavone derivative, is a potent covalently closed circular DNA (cccDNA) inhibitor. cccDNA serves as the template for viral RNA transcription and subsequent viral DNA generation. HBV-IN-30 has the potential for the research of HBV infection .
    HBV-IN-30
  • HY-122209

    HBV Infection
    DVR-01 is a HBV inhibitor with EC50 values of 1.7 and 1.6 μM in AML12HBV10 and HepDES19 cells, respectively. DVR-01 shows antiviral activity against drug-resistant HBV mutants with EC50s of 2.403-3.273 μM. DVR-01 can be used for the research of HBV infection and related diseases .
    DVR-01
  • HY-174819

    HBV Infection
    VNRX-9945 is a potent, broadly and orally active HBV CAM (capsid assembly modulator) with an EC50 of 2.6 nM. VNRX-9945 exhibits excellent and broad antiviral activity against multiple HBV genotypes in vitro, along with favorable pharmacokinetic profiles across multiple species. VNRX-9945 demonstrates robust antiviral efficacy in the adeno-associated virus mice models of HBV (AAV-HBV) infection .
    VNRX-9945
  • HY-148560

    HBV DNA/RNA Synthesis Infection
    ccc_R08 is a non-cytotoxic and orally active cccDNA inhibitor that reduces cccDNA levels in the liver of HBV-infected mice. ccc_R08 can be used in the study of HBV virus (hepatitis B virus) infection .
    ccc_R08
  • HY-B0277A

    ara-AMP; ara-A 5'-monophosphate

    HBV Antibiotic Infection
    Vidarabine phosphate (Ara-AMP), an antiviral agent, inhibits chronic HBV infection . Vidarabine phosphate also against herpes simplex and varicella zoster viruses .
    Vidarabine phosphate
  • HY-B0277AR

    ara-AMP (Standard); ara-A 5'-monophosphate (Standard)

    Reference Standards HBV Antibiotic Infection
    Vidarabine phosphate (Standard) is the analytical standard of Vidarabine phosphate. This product is intended for research and analytical applications. Vidarabine phosphate (Ara-AMP), an antiviral agent, inhibits chronic HBV infection[1][2]. Vidarabine phosphate also against herpes simplex and varicella zoster viruses[3].
    Vidarabine phosphate (Standard)
  • HY-17426
    Famciclovir
    1 Publications Verification

    BRL 42810

    HSV HBV Infection
    Famciclovir (BRL 42810) is an orally active nucleoside analogue. Famciclovir is an antiviral agent with potent activities against HBV, HSV and VZV. Famciclovir can be used for the research of herpesvirus infection .
    Famciclovir
  • HY-107902

    HBV HCV HIV Influenza Virus Infection
    RIG-1 modulator 1 (Compound of claim 13) is an anti-viral compound which can be used against viral infections including influenza virus, HBV, HCV and HIV .
    RIG-1 modulator 1
  • HY-147321

    Tau Protein HBV Infection Neurological Disease
    3'-DMTr-dG(iBu) is a nucleoside for the synthesis of nucleic acid, such as antiviral agents used in the research of viral infection (HBV, HDV), and oligonucleotides against Alzheimer’s disease and other tauopathies .
    3'-DMTr-dG(iBu)
  • HY-116633

    Endogenous Metabolite Infection
    BCM-599 is a HBV (hepatitis B virus) capsid assembly inhibitor with the activity of inhibiting HBV capsid assembly. BCM-599 showed an IC50 value of 0.88μM and a CC50 value of 144μM in HepG2.2.15 cells. When used in combination with lamivudine, BCM-599 showed a synergistic inhibitory effect on viral concentration. BCM-599 can be used as an effective combined inhibition option for HBV infection .
    BCM-599
  • HY-147255A

    (S)-ZM-H1505R

    HBV Infection
    (S)-Canocapavir is the isomer of Canocapavir (HY-147255A). Canocapavir (ZM-H1505R) has orally antiviral activity. Canocapavir is a HBV capsid inhibitor that can be used in the research of Chronic hepatitis B .
    (S)-Canocapavir
  • HY-147255

    ZM-H1505R

    HBV Infection
    Canocapavir (ZM-H1505R) has orally antiviral activity. Canocapavir is a HBV capsid inhibitor that can be used in the research of Chronic hepatitis B. .
    Canocapavir
  • HY-109137
    Selgantolimod
    1 Publications Verification

    GS-9688

    Toll-like Receptor (TLR) HBV Infection
    Selgantolimod (GS-9688) is an orally active, potent and selective toll-like receptor 8 (TLR8) agonist for the treatment of hepatitis B virus (HBV) and human immunodeficiency virus (HIV) infection .
    Selgantolimod
  • HY-145055

    HBV Infection
    HBV-IN-11 is a potent HBsAg secretion inhibitor with an EC50 of 0.46 µM (From patent WO2018085619A1, example 28) .
    HBV-IN-11
  • HY-148560B

    HBV Infection
    cis-ccc_R08 (compound 1) is a flavonoid derivative that can be used in the study of hepatitis B virus (HBV) infection. cis-ccc_R08 is a cccDNA (covalently closed circular DNA) inhibitor .
    cis-ccc_R08
  • HY-137453B

    (1R)-HS-10234

    HBV HIV Infection
    (1R)-Tenofovir amibufenamide ((1R)-HS-10234) is the isomer of Tenofovir amibufenamide, is an orally active antiviral agent. (1R)-Tenofovir amibufenamide ((1R)-HS-10234) is a HIV infection inhibitor and HBV infection inhibitor. (1R)-Tenofovir amibufenamide ((1R)-HS-10234) can be used for HIV infections, hepatitis B research .
    (1R)-Tenofovir amibufenamide
  • HY-17426R

    BRL 42810 (Standard)

    Reference Standards HSV HBV Infection
    Famciclovir (Standard) is the analytical standard of Famciclovir. This product is intended for research and analytical applications. Famciclovir (BRL 42810) is an orally active nucleoside analogue. Famciclovir is an antiviral agent with potent activities against HBV, HSV and VZV. Famciclovir can be used for the research of herpesvirus infection .
    Famciclovir (Standard)
  • HY-148201

    HBV Infection
    Oleana-2,12-dien-28-oic acid is an HBV-DNA inhibitor, HBsAg and HBeAg inhibitor. Oleana-2,12-dien-28-oic acid can be used in hepatitis B virus infection disease research .
    Oleana-2,12-dien-28-oic acid
  • HY-145713A

    HBV-IN-19 TFA

    HBV Infection
    GS-8873 TFA is the TFA salt form of GS-8873 (HY-145713). GS-8873 TFA is an orally active inhibitor for the production of hepatitis B virus (HBV) surface antigen (HBsAg) with an EC50 of 4 nM. GS-8873 TFA exhibits good pharmacokinetic characters in rats and metabolic stability in human hepatocytes. GS-8873 TFA causes neurofunctional deficits in rats and cynomolgus monkeys .
    GS-8873 TFA
  • HY-145713

    HBV-IN-19

    HBV Infection
    GS-8873 is an orally active inhibitor for the production of hepatitis B virus (HBV) surface antigen (HBsAg) with an EC50 of 4 nM. GS-8873 exhibits good pharmacokinetic characters in rats and metabolic stability in human hepatocytes. GS-8873 causes neurofunctional deficits in rats and cynomolgus monkeys .
    GS-8873
  • HY-P3601

    FGF basic (1-24)

    Bacterial HBV Infection Inflammation/Immunology
    Brain Derived Basic Fibroblast Growth Factor (1-24) (FGF basic 1-24) is a synthetic peptide, shows anti-bacterial and anti-HBV activities. Brain Derived Basic Fibroblast Growth Factor (1-24) can be used in infection disease and immune disease research .
    Brain Derived Basic Fibroblast Growth Factor (1-24)
  • HY-17426S1

    BRL 42810-d6

    Isotope-Labeled Compounds HSV HBV Infection
    Famciclovir-d6 (BRL 42810-d6) is deuterium labeled Famciclovir. Famciclovir (BRL 42810) is an orally active nucleoside analogue. Famciclovir is an antiviral agent with potent activities against HBV, HSV and VZV. Famciclovir can be used for the research of herpesvirus infection .
    Famciclovir-d6
  • HY-13859

    L-FMAU

    HBV DNA/RNA Synthesis Orthopoxvirus Infection
    Clevudine (L-FMAU), a nucleoside analog of the unnatural L-configuration, has potent anti-HBV activity with long half-life, low toxicity. Clevudine is a non-competitive inhibitor that is not incorporated into the viral DNA but rather binds to the polymerase. Clevudine is active against cowpox virus respiratory infection in mice .
    Clevudine
  • HY-145592

    RO7020531; RG7854

    Toll-like Receptor (TLR) SARS-CoV HBV Infection
    Ruzotolimod (RO7020531) is an orally active TLR7 agonist. Ruzotolimod inhibits WHV viral replication and, in combination with RO-7049389 (HY-145579), inhibits AAV-HBV viral load. Ruzotolimod can be used to study infection with COVID-19 or SARS-CoV-2 .
    Ruzotolimod
  • HY-109195
    Vebicorvir
    1 Publications Verification

    ABI-H0731

    HBV Infection Inflammation/Immunology
    Vebicorvir (ABI-H0731) is a first-generation hepatitis B virus (HBV) core protein inhibitor. Vebicorvir (ABI-H0731) suppresses covalently closed circular DNA (cccDNA) formation in two de novo infection models with EC50s from 1.84 μM to 7.3 μM .
    Vebicorvir
  • HY-148560A

    HBV Infection
    trans-ccc_R08 (compound 1-B) is a potent cccDNA (covalently closed circular DMA) inhibitor. trans-ccc_R08 inhibits HBeAg level with an IC50 value of 0.08 µM. trans-ccc_R08 has the potential for the research of Hepatitis B Virus infection (HBV) .
    trans-ccc_R08
  • HY-111073

    Y101

    HBV Infection Inflammation/Immunology
    Bentysrepinine (Y101) is an orally active HBV inhibitor with anti-hepatitis B virus infection activity. Bentysrepinine exhibits favorable pharmacokinetic characteristics, with absolute bioavailability of 44.9%, 43.1%, and 19.2% in rats, dogs, and monkeys, respectively, and it does not accumulate in monkeys after 90 days of oral administration. Bentysrepinine is under research in the antiviral and hepatitis fields .
    Bentysrepinine
  • HY-111003

    NZ-4

    HBV Infection
    Isothiafludine is an orally active non-nucleosidic anti-HBV compound. Isothiafludine inhibits hepatitis B virus replication by blocking pregenomic RNA encapsidation .
    Isothiafludine
  • HY-145053

    HBV Infection
    HBV-IN-10 is an enantiomer of compound 6 (WO2021204258A1). Compound 6 is a hepatitis B surface antigen (HBsAg) inhibitor (0.001 μM< EC50 ≤0.05 μM). From patent WO2021204258A1, compound 6 .
    HBV-IN-10
  • HY-145060

    HBV Infection
    HBV-IN-12 is a potent hepatitis B surface antigen (HBsAg) inhibitor. From patent WO2021204252A1, compound 1_B .
    HBV-IN-13
  • HY-145059

    HBV Infection
    HBV-IN-12 is a potent hepatitis B surface antigen (HBsAg) inhibitor (0.001 μM< EC50 ≤0.05 μM). HBV-IN-12 shows anti-HBV DNA activity (0.001 μM<EC50 ≤0.02 μM). From patent WO2021204252A1, compound 15 .
    HBV-IN-12
  • HY-149357

    HBV Infection
    Yhhu6669 is an anti-HBV agent. Yhhu6669 inhibits HBV DNA. Yhhu6669 inhibits HBV replication by inducing the formation of DNA-free capsids. Yhhu6669 decreases HBV DNA and HBcAg in AAV/HBV-infected mice. Yhhu6669 has favorable PK properties .
    Yhhu6669
  • HY-145053A

    HBV Infection
    (5S,8R)-HBV-IN-10 is an enantiomer of compound 6 (WO2021204258A1). Compound 6 is a hepatitis B surface antigen (HBsAg) inhibitor (0.001 μM< EC50 ≤0.05 μM). From patent WO2021204258A1, compound 6 .
    (5S,8R)-HBV-IN-10

Inquiry Online

Your information is safe with us. * Required Fields.

Salutation

 

Country or Region *

Applicant Name *

 

Organization Name *

Department *

     

Email Address *

 

Product Name *

Cat. No.

 

Requested quantity *

Phone Number *

     

Remarks

Inquiry Online

Inquiry Information

Product Name:
Cat. No.:
Quantity:
MCE Japan Authorized Agent: