Search Result

Pathways Recommended:	Cell Cycle/DNA Damage

Results for "

DNA reduction

" in MedChemExpress (MCE) Product Catalog:

By Targets:	DNA Alkylator/Crosslinker (3) DNA/RNA Synthesis (4) Apoptosis (2) Drug Derivative (1) E1/E2/E3 Enzyme (1) Endogenous Metabolite (4) HBV (4) Isotope-Labeled Compounds (3) Nucleoside Antimetabolite/Analog (2) p62 (1) Quinone Reductase (1)
By Research Areas:	Cancer (7) Infection (6) Metabolic Disease (4)
Oligonucleotides:	Nucleotides and their Analogs (3) U (1) Antisense Oligonucleotides (2)

Inhibitors & Agonists

Natural
Products

Isotope-Labeled Compounds

Oligonucleotides

Targets Recommended: DNA-PK DNA Glycosylase DNA Methyltransferase DNA Stain DNA Alkylator/Crosslinker DNA/RNA Synthesis

Cat. No.	Product Name	Target	Research Areas	Chemical Structure

HY-W011142

2'-Deoxyuridine 5'-monophosphate disodium dUMP disodium	Endogenous Metabolite	Infection Metabolic Disease
2'-Deoxyuridine 5'-monophosphate (dUMP) disodium is a deoxynucleotide that is reductively methylated to dTMP (2'-deoxythymidine 5'-monophosphate) by bisubstrate enzyme thymidylate synthase (TS). dTMP is a nucleotide required for DNA synthesis .

HY-147217

Bepirovirsen ISIS 505358	HBV	Infection
Bepirovirsen is an antisense oligonucleotide targeting all HBV messenger RNAs. Bepirovirsen leads to reductions in HBV-derived RNAs, HBV DNA and viral proteins. Bepirovirsen can be used for the research of chronic HBV infection. Bepirovirsen binding site sequence (GCACTTCGCTTCACCTCTGC) .

HY-147217A

Bepirovirsen sodium ISIS 505358 sodium	HBV	Infection
Bepirovirsen (ISIS 505358) sodium is an antisense oligonucleotide targeting all HBV messenger RNAs. Bepirovirsen sodium leads to reductions in HBV-derived RNAs, HBV DNA and viral proteins. Bepirovirsen sodium can be used for the research of chronic HBV infection. Bepirovirsen sodium binding site sequence (GCACTTCGCTTCACCTCTGC) .

HY-13543

Tretazicar CB 1954	Quinone Reductase DNA Alkylator/Crosslinker	Cancer
Tretazicar (CB 1954), an antitumor proagent, is highly selective against the Walker 256 rat tumour line. Tretazicar is enzymatically activated to generate a bifunctional agent, which can form DNA-DNA interstrand cross-links. Tretazicar in rat cells involves the reduction of its 4-nitro group to a 4-hydroxylamine by the enzyme NAD(P)H:quinone oxidoreductase 1 (NQO1) .

HY-177022

ALG-001075	HBV	Infection
ALG-001075, a capsid assembly modulator (CAM), is an orally active HBV inhibitor. ALG-001075 effectively blocks not only HBV DNA production but also extracellular HBsAg/HBeAg and intracellular HBV RNA in primary human hepatocytes. ALG-001075 shows pronounced reductions of circulating HBV DNA in the AAV-HBV mouse model. ALG-001075 can be used for the study of Chronic hepatitis B (CHB) .

HY-144319

SHR5133	HBV	Infection
SHR5133 is a highly potent, orally active HBV capsid assembly modulator. SHR5133 displays HBV DNA reduction (EC₅₀=26.6 nM) .

HY-W394006

2'-Deoxyuridine 5'-monophosphate dUMP	Endogenous Metabolite	Infection Metabolic Disease
2'-Deoxyuridine 5'-monophosphate (dUMP) is a deoxynucleotide that is reductively methylated to dTMP (2'-deoxythymidine 5'-monophosphate) by bisubstrate enzyme thymidylate synthase (TS). dTMP is a nucleotide required for DNA synthesis .

HY-129762

Yoshi-864 NSC-102627	DNA/RNA Synthesis	Cancer
Yoshi-864 (NSC-102627) is an alkylsulfonate *DNA* crosslinker with anticancer activity. Yoshi-864 extends markedly the survival times of mice bearing L1210 leukemia or Ehrlich ascites carcinoma. Yoshi-864 also has a persistent reduction in ability to synthesize *DNA* in tumor cells from mice bearing the Ehrlich tumor .

HY-U00279B

Nitracrine hydrochloride	DNA/RNA Synthesis	Cancer
Nitracrine hydrochloride is a platinum-based antineoplastic drug with selective toxicity to hypoxic cells. Nitracrine hydrochloride exhibits significant cytotoxicity against the Chinese hamster ovary cell line AA8 under hypoxic conditions. Nitracrine hydrochloride exerts its effect by binding to the insertion of DNA and forming covalent adducts. The cytotoxicity of Nitracrine hydrochloride under hypoxic conditions is related to its reductive metabolism to form alkylated substances. At the same time, it may enhance the reactivity to DNA through the insertion of DNA, thereby improving the efficacy. Nitracrine hydrochloride can also inhibit RNA synthesis, contributing to its anti-tumor effect .

HY-13543R

Tretazicar (Standard)	DNA Alkylator/Crosslinker	Cancer
Tretazicar (Standard) is the analytical standard of Tretazicar. This product is intended for research and analytical applications. Tretazicar (CB 1954), an antitumor proagent, is highly selective against the Walker 256 rat tumour line. Tretazicar is enzymatically activated to generate a bifunctional agent, which can form DNA-DNA interstrand cross-links. Tretazicar in rat cells involves the reduction of its 4-nitro group to a 4-hydroxylamine by the enzyme NAD(P)H:quinone oxidoreductase 1 (NQO1) .

HY-129241

AGX51 5+ Cited Publications	DNA/RNA Synthesis DNA Alkylator/Crosslinker	Cancer
AGX51 is the first-in-class pan-Id (inhibitors of DNA-binding/differentiation proteins) antagonist and degrader. AGX51 inhibits Id1-E47 interaction, leading to ubiquitin-mediated degradation of Ids, cell growth arrest, and viability reduction. AGX51 can inhibit TNBC and has an IC₅₀ of about 25 nM. AGX51 can be used in cancer research.

HY-W011500

TCEP hydrochloride Maximum Cited Publications 9 Publications Verification Tris(2-carboxyethyl)phosphine hydrochloride	Drug Derivative	Others
TCEP hydrochloride (Tris(2-carboxyethyl)phosphine hydrochloride) is a non-thiol reducing agent that is more stable and produces a faster S-S reductive reaction than other chemical reductants. TCEP hydrochloride is a trialkylphosphine, selectively reduces protein disuldes without altering the properties or interacting with thiol-directed agents in the reaction mixture. TCEP hydrochloride is also a commonly used reducing agent in the DNA/AuNP chemistry .

HY-W011500S

TCEP-d16 hydrochloride 1 Publications Verification	Isotope-Labeled Compounds	Others
TCEP-d₁₆ (hydrochloride) is the deuterium labeled TCEP hydrochloride . TCEP hydrochloride (Tris(2-carboxyethyl)phosphine hydrochloride) is a non-thiol reducing agent that is more stable and produces a faster S-S reductive reaction than other chemical reductants. TCEP hydrochloride is a trialkylphosphine, selectively reduces protein disuldes without altering the properties or interacting with thiol-directed agents in the reaction mixture. TCEP hydrochloride is also a commonly used reducing agent in the DNA/AuNP chemistry .

HY-16350

BOLD-100 NKP-1339; IT-139; KP-1339	DNA/RNA Synthesis Apoptosis	Cancer
BOLD-100 (NKP-1339; IT-139) is the first-in-class ruthenium-based anticancer agent in development against solid cancer with limited side effects. BOLD-100 induces G2/M cell cycle arrest, blockage of DNA synthesis, and induction of apoptosis via the mitochondrial pathway. BOLD-100 has a high tumor targeting potential, strongly binds to serum proteins such as albumin and transferrin and activates in the reductive tumor milieu .

HY-W013159

2'-Deoxyguanosine 5'-monophosphate disodium 1 Publications Verification 5′-dGMP disodium	Endogenous Metabolite Nucleoside Antimetabolite/Analog	Metabolic Disease
2'-Deoxyguanosine 5'-monophosphate (5′-dGMP) disodium is a mononucleotide having guanine as the nucleobase. 2'-Deoxyguanosine 5'-monophosphate disodium is a reactant involved in analysis of self-assembling in solution and nucleation/growth of G-qudruplexes, nucleophilic trapping and reductive alkylation. 2'-Deoxyguanosine 5'-monophosphate disodium can be used as an oxidizable target. 2'-Deoxyguanosine 5'-monophosphate disodium is a nucleic acid guanosine triphosphate (GTP) derivative and is a nucleotide precursor used in DNA synthesis .

HY-W700621

TCEP-d12 hydrochloride Tris(2-carboxyethyl)phosphine hydrochloride-d₁₂	Isotope-Labeled Compounds Others	Others
TCEP-d₁₂ (hydrochloride) (Tris(2-?carboxyethyl)?phosphine hydrochloride-d₁₂) is deuterium labeled TCEP (hydrochloride). TCEP hydrochloride (Tris(2-carboxyethyl)phosphine hydrochloride) is a non-thiol reducing agent that is more stable and produces a faster S-S reductive reaction than other chemical reductants. TCEP hydrochloride is a trialkylphosphine, selectively reduces protein disuldes without altering the properties or interacting with thiol-directed agents in the reaction mixture. TCEP hydrochloride is also a commonly used reducing agent in the DNA/AuNP chemistry .

HY-151799

P62-RNF168 agonist-1	p62 E1/E2/E3 Enzyme Apoptosis	Cancer
P62-RNF168 agonist-1 (compound 5a) is a low cytotoxicity P62-RNF168 agonist that enhances the interaction between P62 and RNF168. P62-RNF168 agonist-1 induces a reduction in H2A ubiquitination mediated by RNF168 and impairs homologous recombination-mediated DNA repair. P62-RNF168 agonist-1 also inhibits the growth of xenograft tumors in mice in a dose-dependent manner .

HY-W013159S

2'-Deoxyguanosine 5'-monophosphate-13C10,15N5 disodium dGMP-¹³C₁₀,¹⁵N₅	Isotope-Labeled Compounds Endogenous Metabolite Nucleoside Antimetabolite/Analog	Metabolic Disease
2'-Deoxyguanosine 5'-monophosphate- ¹³C₁₀, ¹⁵N₅ (dGMP- ¹³C₁₀, ¹⁵N₅) disodium is the ¹³C and ¹⁵N labeled 2'-Deoxyguanosine 5'-monophosphate disodium (HY-W013159). 2'-Deoxyguanosine 5'-monophosphate (5′-dGMP) disodium is a mononucleotide having guanine as the nucleobase. 2'-Deoxyguanosine 5'-monophosphate disodium is a reactant involved in analysis of self-assembling in solution and nucleation/growth of G-qudruplexes, nucleophilic trapping and reductive alkylation. 2'-Deoxyguanosine 5'-monophosphate disodium can be used as an oxidizable target. 2'-Deoxyguanosine 5'-monophosphate disodium is a nucleic acid guanosine triphosphate (GTP) derivative and is a nucleotide precursor used in DNA synthesis .

Cat. No.	Product Name	Category	Target	Chemical Structure

HY-W011142

2'-Deoxyuridine 5'-monophosphate disodium dUMP disodium	Natural Products Classification of Application Fields Source classification Metabolic Disease Endogenous metabolite Disease Research Fields	Endogenous Metabolite
2'-Deoxyuridine 5'-monophosphate (dUMP) disodium is a deoxynucleotide that is reductively methylated to dTMP (2'-deoxythymidine 5'-monophosphate) by bisubstrate enzyme thymidylate synthase (TS). dTMP is a nucleotide required for DNA synthesis .

HY-W013159

2'-Deoxyguanosine 5'-monophosphate disodium 1 Publications Verification 5′-dGMP disodium	Structural Classification Natural Products Classification of Application Fields Source classification Metabolic Disease Endogenous metabolite Disease Research Fields	Endogenous Metabolite Nucleoside Antimetabolite/Analog
2'-Deoxyguanosine 5'-monophosphate (5′-dGMP) disodium is a mononucleotide having guanine as the nucleobase. 2'-Deoxyguanosine 5'-monophosphate disodium is a reactant involved in analysis of self-assembling in solution and nucleation/growth of G-qudruplexes, nucleophilic trapping and reductive alkylation. 2'-Deoxyguanosine 5'-monophosphate disodium can be used as an oxidizable target. 2'-Deoxyguanosine 5'-monophosphate disodium is a nucleic acid guanosine triphosphate (GTP) derivative and is a nucleotide precursor used in DNA synthesis .

Cat. No.	Product Name	Chemical Structure

HY-W011500S

TCEP-d16 hydrochloride 1 Publications Verification
TCEP-d₁₆ (hydrochloride) is the deuterium labeled TCEP hydrochloride . TCEP hydrochloride (Tris(2-carboxyethyl)phosphine hydrochloride) is a non-thiol reducing agent that is more stable and produces a faster S-S reductive reaction than other chemical reductants. TCEP hydrochloride is a trialkylphosphine, selectively reduces protein disuldes without altering the properties or interacting with thiol-directed agents in the reaction mixture. TCEP hydrochloride is also a commonly used reducing agent in the DNA/AuNP chemistry .

TCEP-d16 hydrochloride

1 Publications Verification

TCEP-d₁₆ (hydrochloride) is the deuterium labeled TCEP hydrochloride . TCEP hydrochloride (Tris(2-carboxyethyl)phosphine hydrochloride) is a non-thiol reducing agent that is more stable and produces a faster S-S reductive reaction than other chemical reductants. TCEP hydrochloride is a trialkylphosphine, selectively reduces protein disuldes without altering the properties or interacting with thiol-directed agents in the reaction mixture. TCEP hydrochloride is also a commonly used reducing agent in the DNA/AuNP chemistry .

HY-W700621

TCEP-d12 hydrochloride
TCEP-d₁₂ (hydrochloride) (Tris(2-?carboxyethyl)?phosphine hydrochloride-d₁₂) is deuterium labeled TCEP (hydrochloride). TCEP hydrochloride (Tris(2-carboxyethyl)phosphine hydrochloride) is a non-thiol reducing agent that is more stable and produces a faster S-S reductive reaction than other chemical reductants. TCEP hydrochloride is a trialkylphosphine, selectively reduces protein disuldes without altering the properties or interacting with thiol-directed agents in the reaction mixture. TCEP hydrochloride is also a commonly used reducing agent in the DNA/AuNP chemistry .

TCEP-d12 hydrochloride

TCEP-d₁₂ (hydrochloride) (Tris(2-?carboxyethyl)?phosphine hydrochloride-d₁₂) is deuterium labeled TCEP (hydrochloride). TCEP hydrochloride (Tris(2-carboxyethyl)phosphine hydrochloride) is a non-thiol reducing agent that is more stable and produces a faster S-S reductive reaction than other chemical reductants. TCEP hydrochloride is a trialkylphosphine, selectively reduces protein disuldes without altering the properties or interacting with thiol-directed agents in the reaction mixture. TCEP hydrochloride is also a commonly used reducing agent in the DNA/AuNP chemistry .

HY-W013159S

2'-Deoxyguanosine 5'-monophosphate-13C10,15N5 disodium
2'-Deoxyguanosine 5'-monophosphate- ¹³C₁₀, ¹⁵N₅ (dGMP- ¹³C₁₀, ¹⁵N₅) disodium is the ¹³C and ¹⁵N labeled 2'-Deoxyguanosine 5'-monophosphate disodium (HY-W013159). 2'-Deoxyguanosine 5'-monophosphate (5′-dGMP) disodium is a mononucleotide having guanine as the nucleobase. 2'-Deoxyguanosine 5'-monophosphate disodium is a reactant involved in analysis of self-assembling in solution and nucleation/growth of G-qudruplexes, nucleophilic trapping and reductive alkylation. 2'-Deoxyguanosine 5'-monophosphate disodium can be used as an oxidizable target. 2'-Deoxyguanosine 5'-monophosphate disodium is a nucleic acid guanosine triphosphate (GTP) derivative and is a nucleotide precursor used in DNA synthesis .

2'-Deoxyguanosine 5'-monophosphate-13C10,15N5 disodium

2'-Deoxyguanosine 5'-monophosphate- ¹³C₁₀, ¹⁵N₅ (dGMP- ¹³C₁₀, ¹⁵N₅) disodium is the ¹³C and ¹⁵N labeled 2'-Deoxyguanosine 5'-monophosphate disodium (HY-W013159). 2'-Deoxyguanosine 5'-monophosphate (5′-dGMP) disodium is a mononucleotide having guanine as the nucleobase. 2'-Deoxyguanosine 5'-monophosphate disodium is a reactant involved in analysis of self-assembling in solution and nucleation/growth of G-qudruplexes, nucleophilic trapping and reductive alkylation. 2'-Deoxyguanosine 5'-monophosphate disodium can be used as an oxidizable target. 2'-Deoxyguanosine 5'-monophosphate disodium is a nucleic acid guanosine triphosphate (GTP) derivative and is a nucleotide precursor used in DNA synthesis .

Cat. No.	Product Name		Classification

HY-W011142

2'-Deoxyuridine 5'-monophosphate disodium dUMP disodium		Nucleotides and their Analogs
2'-Deoxyuridine 5'-monophosphate (dUMP) disodium is a deoxynucleotide that is reductively methylated to dTMP (2'-deoxythymidine 5'-monophosphate) by bisubstrate enzyme thymidylate synthase (TS). dTMP is a nucleotide required for DNA synthesis .

HY-147217

Bepirovirsen ISIS 505358		Antisense Oligonucleotides
Bepirovirsen is an antisense oligonucleotide targeting all HBV messenger RNAs. Bepirovirsen leads to reductions in HBV-derived RNAs, HBV DNA and viral proteins. Bepirovirsen can be used for the research of chronic HBV infection. Bepirovirsen binding site sequence (GCACTTCGCTTCACCTCTGC) .

HY-147217A

Bepirovirsen sodium ISIS 505358 sodium		Antisense Oligonucleotides
Bepirovirsen (ISIS 505358) sodium is an antisense oligonucleotide targeting all HBV messenger RNAs. Bepirovirsen sodium leads to reductions in HBV-derived RNAs, HBV DNA and viral proteins. Bepirovirsen sodium can be used for the research of chronic HBV infection. Bepirovirsen sodium binding site sequence (GCACTTCGCTTCACCTCTGC) .

HY-W013159

2'-Deoxyguanosine 5'-monophosphate disodium 1 Publications Verification 5′-dGMP disodium		Nucleotides and their Analogs
2'-Deoxyguanosine 5'-monophosphate (5′-dGMP) disodium is a mononucleotide having guanine as the nucleobase. 2'-Deoxyguanosine 5'-monophosphate disodium is a reactant involved in analysis of self-assembling in solution and nucleation/growth of G-qudruplexes, nucleophilic trapping and reductive alkylation. 2'-Deoxyguanosine 5'-monophosphate disodium can be used as an oxidizable target. 2'-Deoxyguanosine 5'-monophosphate disodium is a nucleic acid guanosine triphosphate (GTP) derivative and is a nucleotide precursor used in DNA synthesis .

HY-W394006

2'-Deoxyuridine 5'-monophosphate dUMP		Nucleotides and their Analogs U
2'-Deoxyuridine 5'-monophosphate (dUMP) is a deoxynucleotide that is reductively methylated to dTMP (2'-deoxythymidine 5'-monophosphate) by bisubstrate enzyme thymidylate synthase (TS). dTMP is a nucleotide required for DNA synthesis .

Inquiry Online

Your information is safe with us. * Required Fields.

MCE Japan Authorized Agent ナミキ商事株式会社コスモ・バイオ株式会社
Salutation			Country or Region *
Applicant Name *			Organization Name *
Department *
Email Address *			Product Name *
Cat. No.			Requested quantity *
Phone Number *
Remarks

Inquiry Online

Inquiry Information

Product Name:
Cat. No.:
Quantity:
MCE Japan Authorized Agent:

Name
Email *

	Sorry, but the email address you supplied was invalid.

DNA reduction

Inhibitors & Agonists

NaturalProducts

Isotope-Labeled Compounds

Oligonucleotides

Natural
Products