1. Search Result
Search Result
Results for "

ASOs

" in MedChemExpress (MCE) Product Catalog:

26

Inhibitors & Agonists

1

Peptides

24

Oligonucleotides

Cat. No. Product Name Target Research Areas Chemical Structure
  • HY-W570887

    DNA/RNA Synthesis Others
    LNA-A(Bz) amidite can be used for synthesis of ASOs (antisense oligonucleotides) .
    LNA-A(Bz) amidite
  • HY-137501

    Liposome Others
    306-O12B-3 is a lipidoid that can efficiently deliver ASO both in vitro and in vivo. 306-O12B-3 is used to transport small molecule drugs across the blood-brain barrier (BBB) .
    306-O12B-3
  • HY-148687A

    PCSK9 Cardiovascular Disease
    SPC5001 sodium is a locked nucleic acid (LNA)-modifed antisense oligonucleotide (ASO) complementary to human PCSK9 (proprotein convertase subtilisin/kexin type 9) mRNA. SPC5001 sodium can be used for the research of hypercholesterolemia. SPC5001 sequence: 5′-TGmCTACAAAACmCmCA-3′ .
    SPC5001 sodium
  • HY-132582A

    Tau Protein Cancer
    Tau ASO-12 (murine) (sodium) is a Tau-lowering antisense oligonucleotide (ASO) for murine use, and it has the potential for the research of Alzheimer Disease. (Tau ASO-12 sequence – 5′ GCTTTTACTGACCATGCGAG 3′ )
    Tau ASO-12 (murine) (sodium)
  • HY-147410A

    ION-363 sodium

    Others DNA/RNA Synthesis Neurological Disease
    Ulefnersen sodium (ION363) is an Antisense Oligonucleotide (ASO) directed against the 6th intron of the fused-in sarcoma (FUS) transcript to silence FUS in a non-allele-specific manner. Ulefnersen sodium can reduce postnatal levels of FUS protein in the brain and spinal cord in disease-relevant mouse model of ALS-FUS , delaying motor neuron degeneration. Ulefnersen sodium can be used in the research of Amyotrophic Lateral Sclerosis (ALS) .
    Ulefnersen sodium
  • HY-147410

    ION-363

    DNA/RNA Synthesis Others Neurological Disease
    Ulefnersen (ION363) is an Antisense Oligonucleotide (ASO) directed against the 6th intron of the fused-in sarcoma (FUS) transcript to silence FUS in a non-allele-specific manner. Ulefnersen can reduce postnatal levels of FUS protein in the brain and spinal cord in disease-relevant mouse model of ALS-FUS , delaying motor neuron degeneration. Ulefnersen can be used in the research of Amyotrophic Lateral Sclerosis (ALS) .
    Ulefnersen
  • HY-157261

    Others Others
    UNC2383 is an oligonucleotide enhancing compound that can enhance effects of antisense oligonucleotides (ASOs), and splice switching oligonucleotides (SSOs) .
    UNC2383
  • HY-132582C

    BIIB080 sodium; ISIS 814907 sodium

    Tau Protein Neurological Disease
    IONIS-MAPTRx sodium is the first Tau-lowering antisense oligonucleotide (ASO). IONIS-MAPTRx sodium has the potential for the research of Alzheimer Disease .
    IONIS-MAPTRx sodium
  • HY-132581A

    BIIB078 sodium; IONIS-C9Rx sodium

    Others Ras Neurological Disease
    Tadnersen sodium, an antisense oligonucleotide (ASO), selectively targets C9ORF72 transcript variants 1 and 3 that carry the expansion .
    Tadnersen sodium
  • HY-148687

    PCSK9 Cardiovascular Disease
    SPC5001 is a locked nucleic acid (LNA)-modifed antisense oligonucleotide (ASO) complementary to human PCSK9 (proprotein convertase subtilisin/kexin type 9) mRNA. SPC5001 can be used for the research of hypercholesterolemia. SPC5001 sequence: 5′-TGmCTACAAAACmCmCA-3′ .
    SPC5001
  • HY-159695A

    ISIS 426115 sodium

    Glucocorticoid Receptor Metabolic Disease
    IONIS-GCCRRx (ISIS 426115) sodium, a glucocorticoid receptor antagonist, is a 2'-O-methoxyethyl (2'-MOE) antisense oligonucleotide (ASO) .
    IONIS-GCCRRx sodium
  • HY-159695

    ISIS 426115

    Glucocorticoid Receptor Metabolic Disease
    IONIS-GCCRRx (ISIS 426115), a glucocorticoid receptor antagonist, is a 2'-O-methoxyethyl (2'-MOE) antisense oligonucleotide (ASO) .
    IONIS-GCCRRx
  • HY-132581

    BIIB078; IONIS-C9Rx

    Ras Others Neurological Disease
    Tadnersen (BIIB078), an antisense oligonucleotide (ASO), selectively targets C9ORF72 transcript variants 1 and 3 that carry the expansion .
    Tadnersen
  • HY-132582

    BIIB080; ISIS 814907

    Tau Protein Neurological Disease
    IONIS-MAPTRx (BIIB080) is the first Tau-lowering antisense oligonucleotide (ASO). IONIS-MAPTRx has the potential for the research of Alzheimer Disease .
    IONIS-MAPTRx
  • HY-148688

    DNA/RNA Synthesis Others
    ASO 556089 sodium is a 16 nucleotide length gapmer (3-10-3) that targets the human and mouse long non-coding RNA MALAT1, with the sequence: 5’-GmCATTmCTAATAGmCAGmC-3’ .
    ASO 556089 sodium
  • HY-167655

    Androgen Receptor Others
    KF-19418 is an anti-androgen antisense oligonucleotide (ASO) and a hair follicle stimulator. KF-19418 directly stimulated hair follicle in vitro and has hair growth promoting activities in vivo .
    KF-19418
  • HY-158825

    CIVI007 sodium

    PCSK9 Metabolic Disease
    Cepadacursen sodium is a liver-targeting antisense oligonucleotide (ASO), inhibits proprotein convertase subtilisin/kexin type 9 (PCSK9) protein synthesis. Cepadacursen sodium can be used for hypercholesterolemia treatment and the prevention of atherosclerotic cardiovascular disease (ASCVD).
    Cepadacursen sodium
  • HY-148370A

    RG6299 sodium

    Complement System Others
    IONIS-FB-LRx sodium is a specific antisense oligonucleotide (ASO) targeting complement factor B (CFB). IONIS-FB-LRx sodium effectively reduces circulating levels of CFB, and can be used for geographic atrophy (GA) research .
    IONIS-FB-LRx sodium
  • HY-148370

    RG6299

    Complement System Others
    IONIS-FB-LRx is a specific antisense oligonucleotide (ASO) targeting complement factor B (CFB). IONIS-FB-LRx effectively reduces circulating levels of CFB. IONIS-FB-LRx can be used for geographic atrophy (GA) research .
    IONIS-FB-LRx
  • HY-158827A

    PCSK9 Metabolic Disease
    AZD8233 sodium, a liver-targeting antisense oligonucleotide (ASO), inhibits subtilisin/kexin type 9 (PCSK9) protein synthesis. AZD8233 sodium increases the available LDL receptors by reducing PCSK9 levels, thereby clearing LDL from the blood and decreasing LDL-C levels.
    AZD8233 sodium
  • HY-158827

    PCSK9 Metabolic Disease
    AZD8233, a liver-targeting antisense oligonucleotide (ASO), inhibits proprotein convertase subtilisin/kexin type 9 (PCSK9) protein synthesis. AZD8233 increases the available LDL receptors by reducing PCSK9 levels, thereby clearing LDL from the blood and decreasing LDL-C levels.
    AZD8233
  • HY-148130A

    RG6091 sodium; RO7248824 sodium

    E1/E2/E3 Enzyme Others
    Rugonersen sodium is a locked-nucleic acid (LNA)- modified antisense oligonucleotides (ASOs), and results in reduction of ubiquitin-protein ligase E3A (UBE3A) silencing. Angelman syndrome (AS) sodium is a severe neurodevelopmental disorder caused by the loss of neuronal E3 ligase UBE3A, Rugonersen has been used for AS reasearch .
    Rugonersen sodium
  • HY-W570885

    DNA/RNA Synthesis Others
    2'-O-MOE-rC is a 2'-O-MOE modified nucleoside. 2'-O-MOE-rC can be used for synthesis of DNA .
    2'-O-MOE-rC
  • HY-148130

    RG6091; RO7248824

    E1/E2/E3 Enzyme Others
    Rugonersen (RG6091; RO7248824) is a locked-nucleic acid (LNA)- modified antisense oligonucleotides (ASOs), and results in reduction of ubiquitin-protein ligase E3A (UBE3A) silencing. Angelman syndrome (AS) is a severe neurodevelopmental disorder caused by the loss of neuronal E3 ligase UBE3A, Rugonersen has been used for AS reasearch .
    Rugonersen
  • HY-136151
    UNC10217938A
    1 Publications Verification

    Nucleoside Antimetabolite/Analog Others
    UNC10217938A is a 3-deazapteridine analog with strong oligonucleotide enhancing effects. UNC10217938A enhances oligonucleotides effects by modulating their intracellular trafficking and release from endosomes. UNC10217938A also enhances the effects of antisense and siRNA oligonucleotides .
    UNC10217938A
  • HY-108764
    Mipomersen sodium
    1 Publications Verification

    ISIS 301012

    Apolipoprotein HCV Metabolic Disease
    Mipomersen sodium (ISIS 301012) is an antisense oligonucleotide inhibitor of apolipoprotein B (apoB). Mipomersen has anti-HCV effect and reduces the infectivity of the HCV. Mipomersen sodium can be used for the research of homozygous familial hypercholesterolemia (HoFH) .
    Mipomersen sodium

Inquiry Online

Your information is safe with us. * Required Fields.

Salutation

 

Country or Region *

Applicant Name *

 

Organization Name *

Department *

     

Email Address *

 

Product Name *

Cat. No.

 

Requested quantity *

Phone Number *

     

Remarks

Inquiry Online

Inquiry Information

Product Name:
Cat. No.:
Quantity:
MCE Japan Authorized Agent: