Search Result

Results for "

ASOs

" in MedChemExpress (MCE) Product Catalog:

By Targets:	Androgen Receptor (1) Apolipoprotein (1) Complement System (2) DNA/RNA Synthesis (5) E1/E2/E3 Enzyme (2) Glucocorticoid Receptor (2) HCV (1) Liposome (1) Nucleoside Antimetabolite/Analog (2) PCSK9 (5) Ras (2) Tau Protein (3)
By Research Areas:	Cancer (2) Cardiovascular Disease (2) Metabolic Disease (6) Neurological Disease (6)
Oligonucleotides:	A (2) C (1) Nucleoside Phosphoramidites (3) Cationic Lipids (1) Antisense Oligonucleotides (22)

Inhibitors & Agonists

Peptides

Oligonucleotides

Cat. No.	Product Name	Target	Research Areas	Chemical Structure

HY-W570887

LNA-A(Bz) amidite	DNA/RNA Synthesis	Others
LNA-A(Bz) amidite can be used for synthesis of ASOs (antisense oligonucleotides) .

HY-137501

306-O12B-3	Liposome	Others
306-O12B-3 is a lipidoid that can efficiently deliver ASO both in vitro and in vivo. 306-O12B-3 is used to transport small molecule drugs across the blood-brain barrier (BBB) .

HY-148687A

SPC5001 sodium	PCSK9	Cardiovascular Disease
SPC5001 sodium is a locked nucleic acid (LNA)-modifed antisense oligonucleotide (ASO) complementary to human PCSK9 (proprotein convertase subtilisin/kexin type 9) mRNA. SPC5001 sodium can be used for the research of hypercholesterolemia. SPC5001 sequence: 5′-TGmCTACAAAACmCmCA-3′ .

HY-132582A

*Tau ASO-12 (murine) (sodium)*	Tau Protein	Cancer
Tau ^ASO-12 (murine) (sodium) is a Tau-lowering antisense oligonucleotide (ASO) for murine use, and it has the potential for the research of Alzheimer Disease. (Tau ^ASO-12 sequence – 5′ GCTTTTACTGACCATGCGAG 3′ )

HY-147410

Ulefnersen ION-363	DNA/RNA Synthesis Others	Neurological Disease
Ulefnersen (ION363) is an Antisense Oligonucleotide (ASO) directed against the 6th intron of the fused-in sarcoma (FUS) transcript to silence FUS in a non-allele-specific manner. Ulefnersen can reduce postnatal levels of FUS protein in the brain and spinal cord in disease-relevant mouse model of ALS-FUS , delaying motor neuron degeneration. Ulefnersen can be used in the research of Amyotrophic Lateral Sclerosis (ALS) .

HY-147410A

Ulefnersen sodium ION-363 sodium	Others DNA/RNA Synthesis	Neurological Disease
Ulefnersen sodium (ION363) is an Antisense Oligonucleotide (ASO) directed against the 6th intron of the fused-in sarcoma (FUS) transcript to silence FUS in a non-allele-specific manner. Ulefnersen sodium can reduce postnatal levels of FUS protein in the brain and spinal cord in disease-relevant mouse model of ALS-FUS , delaying motor neuron degeneration. Ulefnersen sodium can be used in the research of Amyotrophic Lateral Sclerosis (ALS) .

HY-157261

UNC2383	Others	Others
UNC2383 is an oligonucleotide enhancing compound that can enhance effects of antisense oligonucleotides (ASOs), and splice switching oligonucleotides (SSOs) .

HY-132581A

Tadnersen sodium BIIB078 sodium; IONIS-C9Rx sodium	Others Ras	Neurological Disease
Tadnersen sodium, an antisense oligonucleotide (ASO), selectively targets *C9ORF72* transcript variants 1 and 3 that carry the expansion .

HY-132582C

IONIS-MAPTRx sodium BIIB080 sodium; ISIS 814907 sodium	Tau Protein	Neurological Disease
IONIS-MAPTRx sodium is the first Tau-lowering antisense oligonucleotide (ASO). IONIS-MAPTRx sodium has the potential for the research of Alzheimer Disease .

HY-148687

SPC5001	PCSK9	Cardiovascular Disease
SPC5001 is a locked nucleic acid (LNA)-modifed antisense oligonucleotide (ASO) complementary to human PCSK9 (proprotein convertase subtilisin/kexin type 9) mRNA. SPC5001 can be used for the research of hypercholesterolemia. SPC5001 sequence: 5′-TGmCTACAAAACmCmCA-3′ .

HY-159695A

IONIS-GCCRRx sodium ISIS 426115 sodium	Glucocorticoid Receptor	Metabolic Disease
IONIS-GCCRRx (ISIS 426115) sodium, a glucocorticoid receptor antagonist, is a 2'-O-methoxyethyl (2'-MOE) antisense oligonucleotide (ASO) .

HY-159695

IONIS-GCCRRx ISIS 426115	Glucocorticoid Receptor	Metabolic Disease
IONIS-GCCRRx (ISIS 426115), a glucocorticoid receptor antagonist, is a 2'-O-methoxyethyl (2'-MOE) antisense oligonucleotide (ASO) .

HY-132581

Tadnersen BIIB078; IONIS-C9Rx	Ras Others	Neurological Disease
Tadnersen (BIIB078), an antisense oligonucleotide (ASO), selectively targets *C9ORF72* transcript variants 1 and 3 that carry the expansion .

HY-132582

IONIS-MAPTRx BIIB080; ISIS 814907	Tau Protein	Neurological Disease
IONIS-MAPTRx (BIIB080) is the first Tau-lowering antisense oligonucleotide (ASO). IONIS-MAPTRx has the potential for the research of Alzheimer Disease .

HY-148688

ASO 556089 sodium	DNA/RNA Synthesis	Others
ASO 556089 sodium is a 16 nucleotide length gapmer (3-10-3) that targets the human and mouse long non-coding RNA MALAT1, with the sequence: 5’-GmCATTmCTAATAGmCAGmC-3’ .

HY-167655

KF-19418	Androgen Receptor	Others
KF-19418 is an anti-androgen antisense oligonucleotide (ASO) and a hair follicle stimulator. KF-19418 directly stimulated hair follicle in vitro and has hair growth promoting activities in vivo .

HY-158825

Cepadacursen sodium CIVI007 sodium	PCSK9	Metabolic Disease
Cepadacursen sodium is a liver-targeting antisense oligonucleotide (ASO), inhibits proprotein convertase subtilisin/kexin type 9 (PCSK9) protein synthesis. Cepadacursen sodium can be used for hypercholesterolemia treatment and the prevention of atherosclerotic cardiovascular disease (ASCVD).

HY-148370A

IONIS-FB-LRx sodium RG6299 sodium	Complement System	Others
IONIS-FB-LRx sodium is a specific antisense oligonucleotide (ASO) targeting complement factor B (CFB). IONIS-FB-LRx sodium effectively reduces circulating levels of CFB, and can be used for geographic atrophy (GA) research .

HY-148370

IONIS-FB-LRx RG6299	Complement System	Others
IONIS-FB-LRx is a specific antisense oligonucleotide (ASO) targeting complement factor B (CFB). IONIS-FB-LRx effectively reduces circulating levels of CFB. IONIS-FB-LRx can be used for geographic atrophy (GA) research .

HY-158827A

AZD8233 sodium	PCSK9	Metabolic Disease
AZD8233 sodium, a liver-targeting antisense oligonucleotide (ASO), inhibits subtilisin/kexin type 9 (PCSK9) protein synthesis. AZD8233 sodium increases the available LDL receptors by reducing PCSK9 levels, thereby clearing LDL from the blood and decreasing LDL-C levels.

HY-158827

AZD8233	PCSK9	Metabolic Disease
AZD8233, a liver-targeting antisense oligonucleotide (ASO), inhibits proprotein convertase subtilisin/kexin type 9 (PCSK9) protein synthesis. AZD8233 increases the available LDL receptors by reducing PCSK9 levels, thereby clearing LDL from the blood and decreasing LDL-C levels.

HY-148130A

Rugonersen sodium RG6091 sodium; RO7248824 sodium	E1/E2/E3 Enzyme	Others
Rugonersen sodium is a locked-nucleic acid (LNA)- modified antisense oligonucleotides (ASOs), and results in reduction of ubiquitin-protein ligase E3A (UBE3A) silencing. Angelman syndrome (AS) sodium is a severe neurodevelopmental disorder caused by the loss of neuronal E3 ligase UBE3A, Rugonersen has been used for AS reasearch .

HY-W570885

2'-O-MOE-rC	DNA/RNA Synthesis	Others
2'-O-MOE-rC is a 2'-O-MOE modified nucleoside. 2'-O-MOE-rC can be used for synthesis of DNA .

HY-148130

Rugonersen RG6091; RO7248824	E1/E2/E3 Enzyme	Others
Rugonersen (RG6091; RO7248824) is a locked-nucleic acid (LNA)- modified antisense oligonucleotides (ASOs), and results in reduction of ubiquitin-protein ligase E3A (UBE3A) silencing. Angelman syndrome (AS) is a severe neurodevelopmental disorder caused by the loss of neuronal E3 ligase UBE3A, Rugonersen has been used for AS reasearch .

HY-136151

UNC10217938A 1 Publications Verification	Nucleoside Antimetabolite/Analog	Others
UNC10217938A is a 3-deazapteridine analog with strong oligonucleotide enhancing effects. UNC10217938A enhances oligonucleotides effects by modulating their intracellular trafficking and release from endosomes. UNC10217938A also enhances the effects of antisense and siRNA oligonucleotides .

HY-108764

Mipomersen sodium 1 Publications Verification ISIS 301012	Apolipoprotein HCV	Metabolic Disease
Mipomersen sodium (ISIS 301012) is an antisense oligonucleotide inhibitor of apolipoprotein B (apoB). Mipomersen has anti-HCV effect and reduces the infectivity of the HCV. Mipomersen sodium can be used for the research of homozygous familial hypercholesterolemia (HoFH) .

HY-148503

5'-ODMT cEt N-Bz A Phosphoramidite (Amidite)	Nucleoside Antimetabolite/Analog	Others
5'-ODMT cEt N-Bz A Phosphoramidite (Amidite) is a nucleoside phosphoramidite monomer used to synthesize locked nucleic acid (LNA) analog oligonucleotides. It can be used as a building block of antisense oligonucleotides (ASOs) to target complementary RNA sequences. 5'-ODMT cEt N-Bz A Phosphoramidite (Amidite) locks the furanose ring into an N-type conformation through 2',4'-constrained ethyl (cEt) modification, enhancing hybridization affinity and mismatch discrimination with RNA, while significantly improving the resistance of oligonucleotides to exonuclease digestion. 5'-ODMT cEt N-Bz A Phosphoramidite (Amidite) mediates RNase H-dependent mRNA degradation or inhibits translation by forming a stable hybrid with RNA, thereby achieving gene expression regulation. 5'-ODMT cEt N-Bz A Phosphoramidite (Amidite) is mainly used in the development of antisense drugs, gene function research and oligonucleotide synthesis related to disease treatment .

Cat. No.	Product Name	Target	Research Area

HY-P10567

Pip6a	Peptides	Others
Pip6a is an arginine-rich cell-penetrating peptide. Pip6a has the ability to deliver associated cargoes across the plasma and endosomal membranes and is stable to serum proteolysis. Pip6a is composed of a hydrophobic core region flanked on each side by arginine-rich domains containing β-alanine and aminohexanoyl spacers. Pip6a-conjugated morpholino phosphorodiamidate oligomer (PMO) dramatically enhanced antisense oligonucleotide (ASO) delivery into striated muscles of myotonic dystrophy (DM1) mice .

Cat. No.	Product Name		Classification

HY-W570887

LNA-A(Bz) amidite		Nucleoside Phosphoramidites A
LNA-A(Bz) amidite can be used for synthesis of ASOs (antisense oligonucleotides) .

HY-137501

306-O12B-3		Cationic Lipids
306-O12B-3 is a lipidoid that can efficiently deliver ASO both in vitro and in vivo. 306-O12B-3 is used to transport small molecule drugs across the blood-brain barrier (BBB) .

HY-148687A

SPC5001 sodium		Antisense Oligonucleotides
SPC5001 sodium is a locked nucleic acid (LNA)-modifed antisense oligonucleotide (ASO) complementary to human PCSK9 (proprotein convertase subtilisin/kexin type 9) mRNA. SPC5001 sodium can be used for the research of hypercholesterolemia. SPC5001 sequence: 5′-TGmCTACAAAACmCmCA-3′ .

HY-132582A

*Tau ASO-12 (murine) (sodium)*		Antisense Oligonucleotides
Tau ^ASO-12 (murine) (sodium) is a Tau-lowering antisense oligonucleotide (ASO) for murine use, and it has the potential for the research of Alzheimer Disease. (Tau ^ASO-12 sequence – 5′ GCTTTTACTGACCATGCGAG 3′ )

HY-153734

*Inactive ASO* (in vivo) sodium**		Antisense Oligonucleotides
Inactive ASO (in vivo) sodium is an inactive Antisense Oligonucleotide. ASO is a class of oligonucleotide molecules, usually composed of 20-30 bases, used to interfere with or regulate gene expression. Inactive ASO (in vivo) sodium is not targeted in the rodent genome and can be used as a negative control for Tofersen. Inactive ASO (in vivo) sodium contains thiophosphate skeleton modification and MOE modification. Cytosine in Inactive ASO (in vivo) is 5' methylcytosine. See References for the location of chemical modifications

HY-147410

Ulefnersen ION-363		Antisense Oligonucleotides
Ulefnersen (ION363) is an Antisense Oligonucleotide (ASO) directed against the 6th intron of the fused-in sarcoma (FUS) transcript to silence FUS in a non-allele-specific manner. Ulefnersen can reduce postnatal levels of FUS protein in the brain and spinal cord in disease-relevant mouse model of ALS-FUS , delaying motor neuron degeneration. Ulefnersen can be used in the research of Amyotrophic Lateral Sclerosis (ALS) .

HY-147410A

Ulefnersen sodium ION-363 sodium		Antisense Oligonucleotides
Ulefnersen sodium (ION363) is an Antisense Oligonucleotide (ASO) directed against the 6th intron of the fused-in sarcoma (FUS) transcript to silence FUS in a non-allele-specific manner. Ulefnersen sodium can reduce postnatal levels of FUS protein in the brain and spinal cord in disease-relevant mouse model of ALS-FUS , delaying motor neuron degeneration. Ulefnersen sodium can be used in the research of Amyotrophic Lateral Sclerosis (ALS) .

HY-132581A

Tadnersen sodium BIIB078 sodium; IONIS-C9Rx sodium		Antisense Oligonucleotides
Tadnersen sodium, an antisense oligonucleotide (ASO), selectively targets *C9ORF72* transcript variants 1 and 3 that carry the expansion .

HY-148687

SPC5001		Antisense Oligonucleotides
SPC5001 is a locked nucleic acid (LNA)-modifed antisense oligonucleotide (ASO) complementary to human PCSK9 (proprotein convertase subtilisin/kexin type 9) mRNA. SPC5001 can be used for the research of hypercholesterolemia. SPC5001 sequence: 5′-TGmCTACAAAACmCmCA-3′ .

HY-158830

*MDM4-targeting ASO* sodium**		Antisense Oligonucleotides
MDM4-targeting ASO sodium is a 25mer antisense oligonucleotide targeting?MDM4. MDM4-targeting ASO sodium induced exon 6 skipping, leading to nonsense-mediated decay of the mRNA transcript that excludes exon-6. In multiple human melanoma cell lines and in melanoma patient-derived xenograft (PDX) mouse models, MDM4-targeting ASO-mediated skipping of exon 6 decreased MDM4 abundance, inhibited melanoma growth, and enhanced sensitivity to MAPK-targeting therapeutics.

HY-132582C

IONIS-MAPTRx sodium BIIB080 sodium; ISIS 814907 sodium		Antisense Oligonucleotides
IONIS-MAPTRx sodium is the first Tau-lowering antisense oligonucleotide (ASO). IONIS-MAPTRx sodium has the potential for the research of Alzheimer Disease .

HY-159695A

IONIS-GCCRRx sodium ISIS 426115 sodium		Antisense Oligonucleotides
IONIS-GCCRRx (ISIS 426115) sodium, a glucocorticoid receptor antagonist, is a 2'-O-methoxyethyl (2'-MOE) antisense oligonucleotide (ASO) .

HY-159695

IONIS-GCCRRx ISIS 426115		Antisense Oligonucleotides
IONIS-GCCRRx (ISIS 426115), a glucocorticoid receptor antagonist, is a 2'-O-methoxyethyl (2'-MOE) antisense oligonucleotide (ASO) .

HY-132581

Tadnersen BIIB078; IONIS-C9Rx		Antisense Oligonucleotides
Tadnersen (BIIB078), an antisense oligonucleotide (ASO), selectively targets *C9ORF72* transcript variants 1 and 3 that carry the expansion .

HY-132582

IONIS-MAPTRx BIIB080; ISIS 814907		Antisense Oligonucleotides
IONIS-MAPTRx (BIIB080) is the first Tau-lowering antisense oligonucleotide (ASO). IONIS-MAPTRx has the potential for the research of Alzheimer Disease .

HY-148688

ASO 556089 sodium		Antisense Oligonucleotides
ASO 556089 sodium is a 16 nucleotide length gapmer (3-10-3) that targets the human and mouse long non-coding RNA MALAT1, with the sequence: 5’-GmCATTmCTAATAGmCAGmC-3’ .

HY-158825

Cepadacursen sodium CIVI007 sodium		Antisense Oligonucleotides
Cepadacursen sodium is a liver-targeting antisense oligonucleotide (ASO), inhibits proprotein convertase subtilisin/kexin type 9 (PCSK9) protein synthesis. Cepadacursen sodium can be used for hypercholesterolemia treatment and the prevention of atherosclerotic cardiovascular disease (ASCVD).

HY-148370A

IONIS-FB-LRx sodium RG6299 sodium		Antisense Oligonucleotides
IONIS-FB-LRx sodium is a specific antisense oligonucleotide (ASO) targeting complement factor B (CFB). IONIS-FB-LRx sodium effectively reduces circulating levels of CFB, and can be used for geographic atrophy (GA) research .

HY-148370

IONIS-FB-LRx RG6299		Antisense Oligonucleotides
IONIS-FB-LRx is a specific antisense oligonucleotide (ASO) targeting complement factor B (CFB). IONIS-FB-LRx effectively reduces circulating levels of CFB. IONIS-FB-LRx can be used for geographic atrophy (GA) research .

HY-158827A

AZD8233 sodium		Antisense Oligonucleotides
AZD8233 sodium, a liver-targeting antisense oligonucleotide (ASO), inhibits subtilisin/kexin type 9 (PCSK9) protein synthesis. AZD8233 sodium increases the available LDL receptors by reducing PCSK9 levels, thereby clearing LDL from the blood and decreasing LDL-C levels.

HY-158827

AZD8233		Antisense Oligonucleotides
AZD8233, a liver-targeting antisense oligonucleotide (ASO), inhibits proprotein convertase subtilisin/kexin type 9 (PCSK9) protein synthesis. AZD8233 increases the available LDL receptors by reducing PCSK9 levels, thereby clearing LDL from the blood and decreasing LDL-C levels.

HY-148130A

Rugonersen sodium RG6091 sodium; RO7248824 sodium		Antisense Oligonucleotides
Rugonersen sodium is a locked-nucleic acid (LNA)- modified antisense oligonucleotides (ASOs), and results in reduction of ubiquitin-protein ligase E3A (UBE3A) silencing. Angelman syndrome (AS) sodium is a severe neurodevelopmental disorder caused by the loss of neuronal E3 ligase UBE3A, Rugonersen has been used for AS reasearch .

HY-W570885

2'-O-MOE-rC		Nucleoside Phosphoramidites C
2'-O-MOE-rC is a 2'-O-MOE modified nucleoside. 2'-O-MOE-rC can be used for synthesis of DNA .

HY-148130

Rugonersen RG6091; RO7248824		Antisense Oligonucleotides
Rugonersen (RG6091; RO7248824) is a locked-nucleic acid (LNA)- modified antisense oligonucleotides (ASOs), and results in reduction of ubiquitin-protein ligase E3A (UBE3A) silencing. Angelman syndrome (AS) is a severe neurodevelopmental disorder caused by the loss of neuronal E3 ligase UBE3A, Rugonersen has been used for AS reasearch .

HY-108764

Mipomersen sodium 1 Publications Verification ISIS 301012		Antisense Oligonucleotides
Mipomersen sodium (ISIS 301012) is an antisense oligonucleotide inhibitor of apolipoprotein B (apoB). Mipomersen has anti-HCV effect and reduces the infectivity of the HCV. Mipomersen sodium can be used for the research of homozygous familial hypercholesterolemia (HoFH) .

HY-148503

5'-ODMT cEt N-Bz A Phosphoramidite (Amidite)		Nucleoside Phosphoramidites A
5'-ODMT cEt N-Bz A Phosphoramidite (Amidite) is a nucleoside phosphoramidite monomer used to synthesize locked nucleic acid (LNA) analog oligonucleotides. It can be used as a building block of antisense oligonucleotides (ASOs) to target complementary RNA sequences. 5'-ODMT cEt N-Bz A Phosphoramidite (Amidite) locks the furanose ring into an N-type conformation through 2',4'-constrained ethyl (cEt) modification, enhancing hybridization affinity and mismatch discrimination with RNA, while significantly improving the resistance of oligonucleotides to exonuclease digestion. 5'-ODMT cEt N-Bz A Phosphoramidite (Amidite) mediates RNase H-dependent mRNA degradation or inhibits translation by forming a stable hybrid with RNA, thereby achieving gene expression regulation. 5'-ODMT cEt N-Bz A Phosphoramidite (Amidite) is mainly used in the development of antisense drugs, gene function research and oligonucleotide synthesis related to disease treatment .

Inquiry Online

Your information is safe with us. * Required Fields.

MCE Japan Authorized Agent ナミキ商事株式会社コスモ・バイオ株式会社
Salutation			Country or Region *
Applicant Name *			Organization Name *
Department *
Email Address *			Product Name *
Cat. No.			Requested quantity *
Phone Number *
Remarks

Inquiry Online

Inquiry Information

Product Name:
Cat. No.:
Quantity:
MCE Japan Authorized Agent: