1. Search Result
Search Result
Pathways Recommended: Cell Cycle/DNA Damage
Results for "

DNA sequence

" in MedChemExpress (MCE) Product Catalog:

66

Inhibitors & Agonists

2

Screening Libraries

1

Fluorescent Dye

2

Biochemical Assay Reagents

18

Peptides

4

Natural
Products

1

Antibodies

16

Oligonucleotides

Cat. No. Product Name Target Research Areas Chemical Structure
  • HY-107769
    Duocarmycin TM
    1 Publications Verification

    CBI-TMI

    ADC Payload DNA Alkylator/Crosslinker Antibiotic Cancer
    Duocarmycin TM (CBI-TMI) is a potent antitumor antibiotic. Duocarmycin TM induces a sequence-selective alkylation of duplex DNA.
    Duocarmycin TM
  • HY-D1180

    3,3′-Diethylthiatricarbocyanine iodide

    Fluorescent Dye Others
    DTTCI (3,3′-Diethylthiatricarbocyanine iodide) is an infrared photographic sensitizing dye. DTTCI is a highly sensitive chiroptical reporter of DNA helicity and sequence .
    DTTCI
  • HY-101160

    DRG16

    DNA Alkylator/Crosslinker ADC Payload Cancer
    SG2057 (DRG16) is a PBD dimer containing a pentyldioxy linkage which binds sequence selectively in the minor groove of DNA forming DNA interstrand and intrastrand cross-linked adducts. SG2057 is a highly active antitumor agent .
    SG2057
  • HY-N6181

    Others Endocrinology
    Terrelumamide A is a lumazine-containing peptide. Terrelumamide A is isolated from the culture broth of the marine-derived fungus Aspergillus terreus. Terrelumamide A exhibits pharmacological activity by improving insulin sensitivity. Terrelumamide A has the potential in the application of DNA sequence recognition .
    Terrelumamide A
  • HY-174685

    mRNA Cancer
    Human FLI1 mRNA encodes a transcription factor containing an ETS DNA-binding domain. FLI1 is a sequence-specific transcriptional activator that can recognize the DNA sequence 5''-C[CA]GGAAGT-3''.
    Human FLI1 mRNA
  • HY-E70212

    Hhal

    DNA Methyltransferase Cancer
    Hhal Methyltransferase (Hhal) is a DNA methyltransferase (recognition sequence: GCGC) .
    Hhal Methyltransferase
  • HY-157001

    Biochemical Assay Reagents Others
    7-Deaza-dGTP tetralithium can be used for amplification of GC-rich DNA sequences .
    7-Deaza-dGTP tetralithium
  • HY-E70209

    DNA Methyltransferase Cancer
    EcoRI Methyltransferase is a bacterial sequence-specific S-adenosyl-L-methionine-dependent DNA methyltransferase. EcoRI Methyltransferase relies on a complex conformational mechanism to achieve its remarkable specificity, including DNA bending, base flipping and intercalation into the DNA .
    EcoRI Methyltransferase
  • HY-112858

    Biochemical Assay Reagents Others
    dSPACER is a compound for the phosphoramidite synthesis of oligonucleotides and the creation of the abasic step in the oligonucleotide sequence.Abasic phosphoramidites are used in DNA and oligonucleotide synthesis.
    dSPACER
  • HY-P5343

    p53 Consensus binding sequence

    MDM-2/p53 Others
    p53 CBS (p53 Consensus binding sequence) is a biological active peptide. (p53 consensus DNA binding site)
    p53 CBS
  • HY-147740

    DNA Alkylator/Crosslinker Cancer
    WEHI-150 is a replica of mitoxantrone, is a portent DNA interstrand crosslinksequences and exhibits a preference for methylated CpG sites. Formaldehyde-activated WEHI-150 induces DNA interstrand crosslinks. Formaldehyde-activated WEHI-150 shows Concentration-dependent transcription blockages. WEHI-150 can mediate covalent adducts that are independent of interactions with the N-2 of guanine and is capable of adduct formation at novel DNA sequences .
    WEHI-150
  • HY-155869

    5-Fluoro-2′-deoxycytidine 5′-triphosphate

    DNA/RNA Synthesis Others
    5-fluoro-dCTP is a fluorinated pyrimidine dNTP that can be used as a substrate for the incorporation of fluorine modification into specific DNA sequences by primer extension (PEX) catalyzed by Pwo polymerase .
    5-fluoro-dCTP
  • HY-174715

    mRNA Cancer
    Human ETS variant transcription factor 2 (ETV2) mRNA encodes a protein that can binds to DNA sequences containing the consensus pentanucleotide 5''-CGGA[AT]-3''.
    Human ETV2 mRNA
  • HY-155869A

    5-Fluoro-2′-deoxycytidine 5′-triphosphate sodium

    DNA/RNA Synthesis Others
    5-fluoro-dCTP sodium is a fluorinated pyrimidine dNTP that can be used as a substrate for the incorporation of fluorine modification into specific DNA sequences by primer extension (PEX) catalyzed by Pwo polymerase .
    5-fluoro-dCTP sodium
  • HY-112951
    ChX710
    3 Publications Verification

    STING Cancer
    ChX710 could prime the type I interferon response to cytosolic DNA, which induces the ISRE promoter sequence, specific cellular Interferon-Stimulated Genes (ISGs), and the phosphorylation of Interferon Regulatory Factor (IRF) 3.
    ChX710
  • HY-157549A

    AYX1 sodium

    Nucleoside Antimetabolite/Analog Neurological Disease
    Brivoligide (AYX1) sodium is a double-stranded, unprotected, 23 base-pair oligonucleotide. Brivoligide sodium can reduce acute post-surgical pain. Brivoligide sodium mimics the DNA sequence normally bound by EGR1 on chromosomes .
    Brivoligide sodium
  • HY-157549

    AYX1

    Nucleoside Antimetabolite/Analog Neurological Disease
    Brivoligide (AYX1) is a double-stranded, unprotected, 23 base-pair oligonucleotide. Brivoligide can reduce acute post-surgical pain. Brivoligide mimics the DNA sequence normally bound by EGR1 on chromosomes .
    Brivoligide
  • HY-12455

    ADC Payload Apoptosis Caspase Cancer
    Duocarmycin A, which is one of well-known antitumor antibiotics, is a DNA alkylator and efficiently alkylates adenine N3 at the 3′ end of AT-rich sequences in the DNA. Duocarmycin A, as a chemotherapeutic agent, results HLC-2 cells typically apoptotic changes, including chromatin condensation, sub-G1 accumulation in DNA histogram pattern, and decrease in procaspase-3 and 9 levels .
    Duocarmycin A
  • HY-160728

    3′-O-Azidomethyl dATP

    Biochemical Assay Reagents Others
    3′-O-N3-dATP (3′-O-Azidomethyl dATP) is a modified nucleotide, which is utilized for DNA polymerase. 3′-O-N3-dATP acts as reversible terminator with enhanced raman scattering (SERS) at 2125 cm -1, which determines the DNA sequences continuously .
    3′-O-N3-dATP
  • HY-153494A

    PNT100 sodium

    Bcl-2 Family Cancer
    PNT100 sodium is a 24-base, chemically unmodified DNA oligonucleotide sequence that is complementary to the regulatory region upstream of the BCL-2 gene. Exposure of tumor cells to PNT100 results in suppression of proliferation and cell death.
    Rosomidnar sodium
  • HY-153494

    PNT100

    Bcl-2 Family Cancer
    PNT100 is a 24-base, chemically unmodified DNA oligonucleotide sequence that is complementary to the regulatory region upstream of the BCL-2 gene. Exposure of tumor cells to PNT100 results in suppression of proliferation and cell death.
    Rosomidnar
  • HY-150729

    Toll-like Receptor (TLR) Inflammation/Immunology
    ODN 1982 is a unmethylated oligodeoxyribonucleotide (ODN) with no CpG motif, can be used to prepare DNA vaccines. ODN 1982 inhibits R-848 signaling. ODN 1982 sequence: 5’-tccaggacttctctcaggtt-3’ .
    ODN 1982
  • HY-160226

    STING Inflammation/Immunology
    ISD (interferon stimulatory DNA) Control sodium is a non-immunostimulatory single-stranded oligonucleotide with the same sequence as ISD (HY-160225), its double-stranded counterpart . ISD Control can be used as a negative control for the CDS agonist ISD.
    ISD Control sodium
  • HY-P1781A

    Secretin Receptor Cancer
    Peptide C105Y TFA, a synthetic and cell-penetrating peptide based on the amino acid sequence corresponding to residues 359-374 of α1-antitrypsin, enhances gene expression from DNA nanoparticles .
    Peptide C105Y TFA
  • HY-171692

    Cyclic GMP-AMP Synthase IFNAR Infection
    G3-YSD, a G3-ended Y-form short DNA, is a Cyclic GMP-AMP synthase (cGAS) agonist. G3-YSD is a minimal immunostimulatory DNA motif and activates the type I interferon-inducing DNA sensor cGAS in a structure-and sequence-dependent manner. G3-YSD can be used for the detection of HIV-1 ssDNA .
    G3-YSD
  • HY-P1310
    VKGILS-NH2
    1 Publications Verification

    Protease Activated Receptor (PAR) Inflammation/Immunology
    VKGILS-NH2 is a reversed amino acid sequence control peptide for SLIGKV-NH2 (protease-activated receptor 2 (PAR2) agonist). VKGILS-NH2 has no effect on DNA synthesis in cells .
    VKGILS-NH2
  • HY-147217

    ISIS 505358

    HBV Infection
    Bepirovirsen is an antisense oligonucleotide targeting all HBV messenger RNAs. Bepirovirsen leads to reductions in HBV-derived RNAs, HBV DNA and viral proteins. Bepirovirsen can be used for the research of chronic HBV infection. Bepirovirsen binding site sequence (GCACTTCGCTTCACCTCTGC) .
    Bepirovirsen
  • HY-100758
    FUBP1-IN-1
    2 Publications Verification

    DNA/RNA Synthesis Cancer
    FUBP1-IN-1 is a potent FUSE binding protein 1 (FUBP1) inhibitor which interferes with the binding of FUBP1 to its single stranded target DNA FUSE sequence , with an IC50 value of 11.0 μM .
    FUBP1-IN-1
  • HY-148424

    ADC Payload DNA Alkylator/Crosslinker Cancer
    PBD dimer-2 (compound 2c) is a C8-linked pyrrolobenzodiazepine dimer. PBD dimer-2 can span an extra base pair and cross-link the 5′-Pu-GA(T/A)TC-Py sequence. PBD dimer-2 can be used as a payload for antibody–agent conjugates (ADCs), and it can be used for the research of cancer .
    PBD dimer-2
  • HY-P1310A

    Protease Activated Receptor (PAR) Inflammation/Immunology
    VKGILS-NH2 TFA is a reversed amino acid sequence control peptide for SLIGKV-NH2 (protease-activated receptor 2 (PAR2) agonist). VKGILS-NH2 TFA has no effect on DNA synthesis in cells .
    VKGILS-NH2 TFA
  • HY-168886

    c-Myc Cancer
    Anticancer agent 263 (compound 7) is a potent anticancer agent. Anticancer agent 263 binds to the G-quadruplex DNA (G4) sequence 22-mer Pu22, a mimic of c-Myc DNA. Anticancer agent 263 is a structure modulator, showcasing a significant enhancement in protein α-helix formation and the capability to form supramolecular network. Anticancer agent 263 shows no cytotoxicity .
    Anticancer agent 263
  • HY-147217A

    ISIS 505358 sodium

    HBV Infection
    Bepirovirsen (ISIS 505358) sodium is an antisense oligonucleotide targeting all HBV messenger RNAs. Bepirovirsen sodium leads to reductions in HBV-derived RNAs, HBV DNA and viral proteins. Bepirovirsen sodium can be used for the research of chronic HBV infection. Bepirovirsen sodium binding site sequence (GCACTTCGCTTCACCTCTGC) .
    Bepirovirsen sodium
  • HY-E70371

    Biochemical Assay Reagents Others
    Cre recombinase is a resolvase derived from the P1 bacteriophage. Cre recombinase catalyzes site-specific recombination between two loxP DNA sequences, converts dimers of P1 chromosome into monomers before cell division. Cre recombinase is utilized in genetic engineering and molecular biology applications .
    Cre recombinase
  • HY-P1286A

    PKC Neurological Disease
    PKC β pseudosubstrate TFA is a selective cell-permeable inhibitor of PKC .
    PKC β pseudosubstrate TFA
  • HY-P1286

    PKC Neurological Disease
    PKC β pseudosubstrate is a selective cell-permeable inhibitor of PKC .
    PKC β pseudosubstrate
  • HY-W406070

    LNA-G

    Nucleoside Antimetabolite/Analog DNA/RNA Synthesis Others
    2′-O,4′-C-Methyleneguanosine (LNA-G) is a reverse guanine analog, where LNA (locked nucleic acid) is a nucleic acid analog. LNA modification can be widely used in various fields, such as effective binding affinity with complementary sequences and stronger nuclease resistance than natural nucleotides, providing great potential for application in disease diagnosis and research. LNA-G can also be incorporated into the DNA chain by KOD DNA polymerase .
    2'-O,4'-C-Methyleneguanosine
  • HY-12456

    Antibiotic ADC Payload DNA Alkylator/Crosslinker Necroptosis Apoptosis Cancer
    Duocarmycin SA is an orally active antitumor antibiotic with an IC50 of 10 pM . Duocarmycin SA is an extremely potent cytotoxic agent capable of inducing a sequence-selective alkylation of duplex DNA. Duocarmycin SA demonstrates synergistic cytotoxicity against glioblastoma multiforme (GBM) cells treated with proton radiation in vitro .
    Duocarmycin SA
  • HY-W591768

    Fluorescent Dye Others
    (E)-4-(4-(Dimethylamino)styryl)-1-methylpyridin-1-ium (iodide) (Py-NMe2) is a styryl-based dye for fluorescence and CD-based sensing of various ds-DNA/RNA sequence. ( maxλAbs = 450 nm, maxλEm = 615 nm) .
    (E)-4-(4-(Dimethylamino)styryl)-1-methylpyridin-1-ium iodide
  • HY-13642
    RG108
    Maximum Cited Publications
    13 Publications Verification

    N-Phthalyl-L-tryptophan

    DNA Methyltransferase Cancer
    RG108 (N-Phthalyl-L-tryptophan) is a non-nucleoside DNA methyltransferases (DNMTs) inhibitor (IC50=115 nM) that blocks the DNMTs active site. RG108 (N-Phthalyl-L-tryptophan) causes demethylation and reactivation of tumor suppressor genes, but it does not affect the methylation of centromeric satellite sequences .
    RG108
  • HY-E70090

    DNA/RNA Synthesis Others
    T7 RNA polymerase is a polymerase expressed by Escherichia coli from the RNA polymerase gene of T7 bacteriophage. T7 RNA polymerase is highly specific and involved in in vitro transcription (IVT) of mRNA. In the presence of Mg 2+, T7 RNA polymerase only uses the single-stranded or double-stranded DNA containing the T7 promoter sequence as a template, and uses NTP as a substrate to synthesize RNA complementary to the single-stranded DNA downstream of the promoter .
    T7 RNA polymerase
  • HY-174573

    mRNA Neurological Disease
    Human NEUROD1 mRNA encodes the human neuronal differentiation 1 (NEUROD1)protein, a member of the NeuroD family of basic helix-loop-helix (bHLH) transcription factors. NEUROD1 forms heterodimers with other bHLH proteins and activates transcription of genes that contain a specific DNA sequence known as the E-box.
    Human NEUROD1 mRNA
  • HY-135900

    ADC Payload Bacterial Cancer
    Aniline-MPB-amino-C3-PBD is a cytotoxic agent comprised non-alkylating group. Aniline-MPB-amino-C3-PBD is a sequence-selective DNA minor-groove binding agent. Aniline-MPB-amino-C3-PBD acts as the payload for ADCs. Antimicrobial activity .
    Aniline-MPB-amino-C3-PBD
  • HY-160728A

    3′-O-Azidomethyl dATP trisodium

    Biochemical Assay Reagents Others
    3′-O-N3-dATP trisodium (3′-O-Azidomethyl dATP trisodium) is the trisodium salt form of 3′-O-N3-dATP. 3′-O-N3-dATP trisodium is a modified nucleotide, which is utilized for DNA polymerase. 3′-O-N3-dATP trisodium acts as reversible terminator with enhanced raman scattering (SERS) at 2125 cm -1, which determines the DNA sequences continuously .
    3′-O-N3-dATP trisodium
  • HY-107767

    DC 81

    Antibiotic Apoptosis DNA/RNA Synthesis Cancer
    Antibiotic DC 81 (DC 81), an antitumor antibiotic produced by Streptomyces species, is a PBD (pyrrolo[2,1-c][1,4]benzodiazepine). Antibiotic DC 81 is potent inhibitor of nucleic acid synthesis. Antibiotic DC 81 can recognize and bind to specific sequences of DNA and form a labile covalent adduct .
    Antibiotic DC 81
  • HY-132243

    Nuclear Factor of activated T Cells (NFAT) Inflammation/Immunology
    NFAT Inhibitor-3 (Compound 10) is a factor nuclear factor of activated T cells (NFAT) inhibitor. NFAT Inhibitor-3 inhibits IL-2 production. NFAT Inhibitor-3 binds in a sequence-selective manner directly to DNA. NFAT Inhibitor-3 can be used for the research of transcription factor dysregulation .
    NFAT Inhibitor-3
  • HY-15435
    CHAPS
    3 Publications Verification

    Biochemical Assay Reagents Others
    CHAPS is a non-covalent reversible stabilizer of nucleosomes derived from cholic acid (HY-N0324). CHAPS can stabilize the ultrastructure of nucleosomes, inhibit the spontaneous dissociation of nucleosomes at low concentrations, and maintain the integrity of the basic structural units of chromatin. CHAPS can promote the sliding of histone cores along the DNA chain and reduce sequence-specific binding. CHAPS can also be used as a zwitterionic detergent to dissolve membrane proteins, stabilize various protein-DNA complexes, and retain the biochemical activity of proteins in solution .
    CHAPS
  • HY-15435A
    CHAPS hydrate
    3 Publications Verification

    Biochemical Assay Reagents Others
    CHAPS hydrate is a non-covalent reversible stabilizer of nucleosomes derived from Cholic Acid (HY-N0324). CHAPS hydrate can stabilize the ultrastructure of nucleosomes, inhibit the spontaneous dissociation of nucleosomes at low concentrations, and maintain the integrity of the basic structural units of chromatin. CHAPS hydrate can promote the sliding of histone cores along the DNA chain and reduce sequence-specific binding. CHAPS hydrate can also be used as a zwitterionic detergent to dissolve membrane proteins, stabilize various protein-DNA complexes, and retain the biochemical activity of proteins in solution .
    CHAPS hydrate
  • HY-W040129
    Chromomycin A3
    1 Publications Verification

    DNA Alkylator/Crosslinker DNA/RNA Synthesis Apoptosis Caspase Infection Neurological Disease Cancer
    Chromomycin A3 is an inhibitor that selectively binds to GC-rich DNA sequences. Chromomycin A3 targets the DNA minor groove after forming a dimer with Mg 2+. Chromomycin A3 inhibits DNA replication and transcription, blocks the binding of Sp1 transcription factor to target gene promoters, downregulates the expression of anti-apoptotic proteins such as FLIP, Mcl-1, and XIAP, and induces S-phase cycle arrest and caspase-dependent apoptosis in tumor cells. Chromomycin A3 can antagonize oxidative stress induced by glutathione depletion and neuronal apoptosis induced by Camptothecin (HY-15660). Chromomycin A3 can be used in basic research on malignant tumors such as cholangiocarcinoma, and is a potential chemosensitizer and GC-rich region probe .
    Chromomycin A3
  • HY-130670

    GABA Receptor Neurological Disease
    CGP 54626A (free base) is a GABAB receptor modulator, which is essential in the central and peripheral nervous systems. It is used as a tool to identify and characterize GABAB receptor agonists and antagonists, which will aid in the development of drugs targeting diseases related to these systems. This discovery involves purified GABAB receptors, receptor proteins and their encoding nucleic acids, facilitating the study of new members of the GABAB receptor family through DNA cloning technology and sequence-derived probes .
    CGP 54626A free base
  • HY-106262B
    Delcasertib hydrochloride
    3 Publications Verification

    KAI-9803 hydrochloride; BMS-875944 hydrochloride

    PKC Cardiovascular Disease Inflammation/Immunology
    Delcasertib (KAI-9803) hydrochloride is a potent and selective δ-protein kinase C (δPKC) inhibitor. Delcasertib (KAI-9803) hydrochloride could ameliorate injury associated with ischemia and reperfusion in animal models of acute myocardial infarction (MI) .
    Delcasertib hydrochloride

Inquiry Online

Your information is safe with us. * Required Fields.

Salutation

 

Country or Region *

Applicant Name *

 

Organization Name *

Department *

     

Email Address *

 

Product Name *

Cat. No.

 

Requested quantity *

Phone Number *

     

Remarks

Inquiry Online

Inquiry Information

Product Name:
Cat. No.:
Quantity:
MCE Japan Authorized Agent: