Search Result

Pathways Recommended:	Cell Cycle/DNA Damage

Results for "

DNA sequence

" in MedChemExpress (MCE) Product Catalog:

By Targets:	DNA Alkylator/Crosslinker (6) DNA Methyltransferase (3) DNA/RNA Synthesis (9) ADC Payload (6) AIM2 (2) Antibiotic (6) Apoptosis (6) Bacterial (4) Bcl-2 Family (2) Biochemical Assay Reagents (9) c-Myc (1) Caspase (2) CXCR (2) Drug Intermediate (1) Fluorescent Dye (3) Fungal (1) GABA Receptor (1) HBV (2) HIF/HIF Prolyl-Hydroxylase (1) MDM-2/p53 (2) Necroptosis (1) Neuropeptide Y Receptor (2) Nuclear Factor of activated T Cells (NFAT) (1) Nucleoside Antimetabolite/Analog (3) Oxytocin Receptor (2) PI3K (1) PKC (4) Protease Activated Receptor (PAR) (2) Reference Standards (1) Secretin Receptor (1) STING (2) Toll-like Receptor (TLR) (3)
By Research Areas:	Cancer (28) Cardiovascular Disease (3) Endocrinology (5) Infection (6) Inflammation/Immunology (11) Metabolic Disease (1) Neurological Disease (9)
Oligonucleotides:	Nucleosides and their Analogs (1) Nucleoside Phosphoramidites (1) G (1) CpG ODNs (6) Antisense Oligonucleotides (4)

Inhibitors & Agonists

Screening Libraries

Fluorescent Dye

Biochemical Assay Reagents

Peptides

Natural
Products

Antibodies

Oligonucleotides

Targets Recommended: DNA-PK DNA Glycosylase DNA Methyltransferase DNA Stain DNA Alkylator/Crosslinker DNA/RNA Synthesis

Cat. No.	Product Name	Target	Research Areas	Chemical Structure

HY-107769

Duocarmycin TM 1 Publications Verification CBI-TMI	ADC Payload DNA Alkylator/Crosslinker Antibiotic	Cancer
Duocarmycin TM (CBI-TMI) is a potent antitumor antibiotic. Duocarmycin TM induces a sequence-selective alkylation of duplex DNA.

HY-D1180

DTTCI 3,3′-Diethylthiatricarbocyanine iodide	Fluorescent Dye	Others
DTTCI (3,3′-Diethylthiatricarbocyanine iodide) is an infrared photographic sensitizing dye. DTTCI is a highly sensitive chiroptical reporter of **DNA helicity and sequence** .

HY-N6181

Terrelumamide A	Others	Endocrinology
Terrelumamide A is a lumazine-containing peptide. Terrelumamide A is isolated from the culture broth of the marine-derived fungus Aspergillus terreus. Terrelumamide A exhibits pharmacological activity by improving insulin sensitivity. Terrelumamide A has the potential in the application of DNA sequence recognition .

HY-E70212

Hhal Methyltransferase Hhal	DNA Methyltransferase	Cancer
Hhal Methyltransferase (Hhal) is a DNA methyltransferase (recognition sequence: GCGC) .

HY-E70401

Golden Taq DNA Polymerase	Biochemical Assay Reagents	Others
Golden Taq DNA Polymerase is a thermostable enzyme that can be used in molecular biology to amplify DNA sequences through the polymerase chain reaction (PCR) .

HY-157001

7-Deaza-dGTP tetralithium	Biochemical Assay Reagents	Others
7-Deaza-dGTP tetralithium can be used for amplification of GC-rich DNA sequences .

HY-E70402

Double-block Hotstart Taq DNA Polymerase	Biochemical Assay Reagents	Others
that can be used in molecular biology to amplify DNA sequences through the polymerase chain reaction (PCR) .

HY-E70209

EcoRI Methyltransferase	DNA Methyltransferase	Cancer
EcoRI Methyltransferase is a bacterial sequence-specific S-adenosyl-L-methionine-dependent DNA methyltransferase. EcoRI Methyltransferase relies on a complex conformational mechanism to achieve its remarkable specificity, including DNA bending, base flipping and intercalation into the DNA .

HY-112858

dSPACER	Biochemical Assay Reagents	Others
dSPACER is a compound for the phosphoramidite synthesis of oligonucleotides and the creation of the abasic step in the oligonucleotide sequence.Abasic phosphoramidites are used in DNA and oligonucleotide synthesis.

HY-P5343

p53 CBS p53 Consensus binding sequence	MDM-2/p53	Others
p53 CBS (p53 Consensus binding sequence) is a biological active peptide. (p53 consensus DNA binding site)

HY-101160

SG2057 DRG16	DNA Alkylator/Crosslinker ADC Payload	Cancer
SG2057 (DRG16) is a PBD dimer containing a pentyldioxy linkage which binds sequence selectively in the minor groove of *DNA* forming DNA interstrand and intrastrand cross-linked adducts. SG2057 is a highly active antitumor agent .

HY-147740

WEHI-150	DNA Alkylator/Crosslinker	Cancer
WEHI-150 is a replica of mitoxantrone, is a portent DNA interstrand crosslinksequences and exhibits a preference for methylated CpG sites. Formaldehyde-activated WEHI-150 induces DNA interstrand crosslinks. Formaldehyde-activated WEHI-150 shows Concentration-dependent transcription blockages. WEHI-150 can mediate covalent adducts that are independent of interactions with the N-2 of guanine and is capable of adduct formation at novel DNA sequences .

HY-155869

5-fluoro-dCTP 5-Fluoro-2′-deoxycytidine 5′-triphosphate	DNA/RNA Synthesis	Others
5-fluoro-dCTP is a fluorinated pyrimidine dNTP that can be used as a substrate for the incorporation of fluorine modification into specific DNA sequences by primer extension (PEX) catalyzed by Pwo polymerase .

HY-155869A

5-fluoro-dCTP sodium 5-Fluoro-2′-deoxycytidine 5′-triphosphate sodium	DNA/RNA Synthesis	Others
5-fluoro-dCTP sodium is a fluorinated pyrimidine dNTP that can be used as a substrate for the incorporation of fluorine modification into specific DNA sequences by primer extension (PEX) catalyzed by Pwo polymerase .

HY-112951

ChX710 2 Publications Verification	STING	Cancer
ChX710 could prime the type I interferon response to cytosolic DNA, which induces the ISRE promoter sequence, specific cellular Interferon-Stimulated Genes (ISGs), and the phosphorylation of Interferon Regulatory Factor (IRF) 3.

HY-157549A

Brivoligide sodium AYX1 sodium	Nucleoside Antimetabolite/Analog	Neurological Disease
Brivoligide (AYX1) sodium is a double-stranded, unprotected, 23 base-pair oligonucleotide. Brivoligide sodium can reduce acute post-surgical pain. Brivoligide sodium mimics the DNA sequence normally bound by EGR1 on chromosomes .

HY-157549

Brivoligide AYX1	Nucleoside Antimetabolite/Analog	Neurological Disease
Brivoligide (AYX1) is a double-stranded, unprotected, 23 base-pair oligonucleotide. Brivoligide can reduce acute post-surgical pain. Brivoligide mimics the DNA sequence normally bound by EGR1 on chromosomes .

HY-12455

Duocarmycin A	ADC Payload Apoptosis Caspase	Cancer
Duocarmycin A, which is one of well-known antitumor antibiotics, is a DNA alkylator and efficiently alkylates adenine N3 at the 3′ end of AT-rich sequences in the DNA. Duocarmycin A, as a chemotherapeutic agent, results HLC-2 cells typically apoptotic changes, including chromatin condensation, sub-G1 accumulation in DNA histogram pattern, and decrease in procaspase-3 and 9 levels .

HY-160728

3′-O-N3-dATP 3′-O-Azidomethyl dATP	Biochemical Assay Reagents	Others
3′-O-N3-dATP (3′-O-Azidomethyl dATP) is a modified nucleotide, which is utilized for DNA polymerase. 3′-O-N3-dATP acts as reversible terminator with enhanced raman scattering (SERS) at 2125 cm ^-1, which determines the DNA sequences continuously .

HY-153494A

Rosomidnar sodium PNT100 sodium	Bcl-2 Family	Cancer
PNT100 sodium is a 24-base, chemically unmodified DNA oligonucleotide sequence that is complementary to the regulatory region upstream of the BCL-2 gene. Exposure of tumor cells to PNT100 results in suppression of proliferation and cell death.

HY-153494

Rosomidnar PNT100	Bcl-2 Family	Cancer
PNT100 is a 24-base, chemically unmodified DNA oligonucleotide sequence that is complementary to the regulatory region upstream of the BCL-2 gene. Exposure of tumor cells to PNT100 results in suppression of proliferation and cell death.

HY-150729

ODN 1982	Toll-like Receptor (TLR)	Inflammation/Immunology
ODN 1982 is a unmethylated oligodeoxyribonucleotide (ODN) with no CpG motif, can be used to prepare DNA vaccines. ODN 1982 inhibits R-848 signaling. ODN 1982 sequence: 5’-tccaggacttctctcaggtt-3’ .

HY-P1781A

Peptide C105Y TFA	Secretin Receptor	Cancer
Peptide C105Y TFA, a synthetic and cell-penetrating peptide based on the amino acid sequence corresponding to residues 359-374 of α1-antitrypsin, enhances gene expression from DNA nanoparticles .

HY-160226

ISD Control sodium	STING	Inflammation/Immunology
ISD (interferon stimulatory DNA) Control sodium is a non-immunostimulatory single-stranded oligonucleotide with the same sequence as ISD (HY-160225), its double-stranded counterpart . ISD Control can be used as a negative control for the CDS agonist ISD.

HY-147217

Bepirovirsen ISIS 505358	HBV	Infection
Bepirovirsen is an antisense oligonucleotide targeting all HBV messenger RNAs. Bepirovirsen leads to reductions in HBV-derived RNAs, HBV DNA and viral proteins. Bepirovirsen can be used for the research of chronic HBV infection. Bepirovirsen binding site sequence (GCACTTCGCTTCACCTCTGC) .

HY-P1310

VKGILS-NH2 1 Publications Verification	Protease Activated Receptor (PAR)	Inflammation/Immunology
VKGILS-NH2 is a reversed amino acid sequence control peptide for SLIGKV-NH2 (protease-activated receptor 2 (PAR2) agonist). VKGILS-NH2 has no effect on DNA synthesis in cells .

HY-100758

FUBP1-IN-1 2 Publications Verification	DNA/RNA Synthesis	Cancer
FUBP1-IN-1 is a potent FUSE binding protein 1 (FUBP1) inhibitor which interferes with the binding of FUBP1 to its single stranded target DNA FUSE sequence , with an IC₅₀ value of 11.0 μM .

HY-148424

PBD dimer-2	ADC Payload DNA Alkylator/Crosslinker	Cancer
PBD dimer-2 (compound 2c) is a C8-linked pyrrolobenzodiazepine dimer. PBD dimer-2 can span an extra base pair and cross-link the 5′-Pu-GA(T/A)TC-Py sequence. PBD dimer-2 can be used as a payload for antibody–agent conjugates (ADCs), and it can be used for the research of cancer .

HY-400706

Duocarmycin SA intermediate-2	Antibiotic	Cancer
Duocarmycin SA intermediate-2 is an intermediate in the synthesis of the antibiotic Duocarmycin SA (HY-12456). Duocarmycin SA intermediate-2 induces sequence-selective alkylation of double-stranded DNA and has synergistic, tumor suppressor cytotoxicity with proton irradiation .

HY-400705

Duocarmycin SA intermediate-1	Antibiotic	Cancer
Duocarmycin SA intermediate-1 is an intermediate in the synthesis of the antibiotic Duocarmycin SA (HY-12456). Duocarmycin SA intermediate-1 induces sequence-selective alkylation of double-stranded DNA and has synergistic, tumor-suppressive cytotoxicity with proton irradiation .

HY-P1310A

VKGILS-NH2 TFA	Protease Activated Receptor (PAR)	Inflammation/Immunology
VKGILS-NH2 TFA is a reversed amino acid sequence control peptide for SLIGKV-NH2 (protease-activated receptor 2 (PAR2) agonist). VKGILS-NH2 TFA has no effect on DNA synthesis in cells .

HY-147217A

Bepirovirsen sodium ISIS 505358 sodium	HBV	Infection
Bepirovirsen (ISIS 505358) sodium is an antisense oligonucleotide targeting all HBV messenger RNAs. Bepirovirsen sodium leads to reductions in HBV-derived RNAs, HBV DNA and viral proteins. Bepirovirsen sodium can be used for the research of chronic HBV infection. Bepirovirsen sodium binding site sequence (GCACTTCGCTTCACCTCTGC) .

HY-168886

Anticancer agent 263	c-Myc	Cancer
Anticancer agent 263 (compound 7) is a potent anticancer agent. Anticancer agent 263 binds to the G-quadruplex DNA (G4) sequence 22-mer Pu22, a mimic of c-Myc DNA. Anticancer agent 263 is a structure modulator, showcasing a significant enhancement in protein α-helix formation and the capability to form supramolecular network. Anticancer agent 263 shows no cytotoxicity .

HY-E70371

Cre recombinase	Biochemical Assay Reagents	Others
Cre recombinase is a resolvase derived from the P1 bacteriophage. Cre recombinase catalyzes site-specific recombination between two loxP DNA sequences, converts dimers of P1 chromosome into monomers before cell division. Cre recombinase is utilized in genetic engineering and molecular biology applications .

HY-12456

Duocarmycin SA	Antibiotic ADC Payload DNA Alkylator/Crosslinker Necroptosis Apoptosis	Cancer
Duocarmycin SA is an orally active antitumor antibiotic with an IC₅₀ of 10 pM . Duocarmycin SA is an extremely potent cytotoxic agent capable of inducing a sequence-selective alkylation of duplex DNA. Duocarmycin SA demonstrates synergistic cytotoxicity against glioblastoma multiforme (GBM) cells treated with proton radiation in vitro .

HY-W406070

2'-O,4'-C-Methyleneguanosine LNA-G	Nucleoside Antimetabolite/Analog DNA/RNA Synthesis	Others
2′-O,4′-C-Methyleneguanosine (LNA-G) is a reverse guanine analog, where LNA (locked nucleic acid) is a nucleic acid analog. LNA modification can be widely used in various fields, such as effective binding affinity with complementary sequences and stronger nuclease resistance than natural nucleotides, providing great potential for application in disease diagnosis and research. LNA-G can also be incorporated into the DNA chain by KOD DNA polymerase .

HY-P1286

PKC β pseudosubstrate	PKC	Neurological Disease
PKC β pseudosubstrate is a selective cell-permeable inhibitor of PKC .

HY-P1286A

PKC β pseudosubstrate TFA	PKC	Neurological Disease
PKC β pseudosubstrate TFA is a selective cell-permeable inhibitor of PKC .

HY-W591768

(E)-4-(4-(Dimethylamino)styryl)-1-methylpyridin-1-ium iodide	Fluorescent Dye	Others
(E)-4-(4-(Dimethylamino)styryl)-1-methylpyridin-1-ium (iodide) (Py-NMe₂) is a styryl-based dye for fluorescence and CD-based sensing of various ds-DNA/RNA sequence. ( ^maxλ_Abs = 450 nm, ^maxλ_Em = 615 nm) .

HY-13642

RG108 Maximum Cited Publications 10 Publications Verification N-Phthalyl-L-tryptophan	DNA Methyltransferase	Cancer
RG108 (N-Phthalyl-L-tryptophan) is a non-nucleoside DNA methyltransferases (DNMTs) inhibitor (IC₅₀=115 nM) that blocks the DNMTs active site. RG108 (N-Phthalyl-L-tryptophan) causes demethylation and reactivation of tumor suppressor genes, but it does not affect the methylation of centromeric satellite sequences .

HY-E70090

T7 RNA polymerase	DNA/RNA Synthesis	Others
T7 RNA polymerase is a polymerase expressed by Escherichia coli from the RNA polymerase gene of T7 bacteriophage. T7 RNA polymerase is highly specific and involved in in vitro transcription (IVT) of mRNA. In the presence of Mg ²⁺, T7 RNA polymerase only uses the single-stranded or double-stranded DNA containing the T7 promoter sequence as a template, and uses NTP as a substrate to synthesize RNA complementary to the single-stranded DNA downstream of the promoter .

HY-135900

Aniline-MPB-amino-C3-PBD	ADC Payload Bacterial	Cancer
Aniline-MPB-amino-C3-PBD is a cytotoxic agent comprised non-alkylating group. Aniline-MPB-amino-C3-PBD is a sequence-selective *DNA* minor-groove binding agent. Aniline-MPB-amino-C3-PBD acts as the payload for ADCs. Antimicrobial activity .

HY-160728A

3′-O-N3-dATP trisodium 3′-O-Azidomethyl dATP trisodium	Biochemical Assay Reagents	Others
3′-O-N3-dATP trisodium (3′-O-Azidomethyl dATP trisodium) is the trisodium salt form of 3′-O-N3-dATP. 3′-O-N3-dATP trisodium is a modified nucleotide, which is utilized for DNA polymerase. 3′-O-N3-dATP trisodium acts as reversible terminator with enhanced raman scattering (SERS) at 2125 cm ^-1, which determines the DNA sequences continuously .

HY-107767

Antibiotic DC 81 DC 81	Antibiotic Apoptosis DNA/RNA Synthesis	Cancer
Antibiotic DC 81 (DC 81), an antitumor antibiotic produced by Streptomyces species, is a PBD (pyrrolo[2,1-c][1,4]benzodiazepine). Antibiotic DC 81 is potent inhibitor of nucleic acid synthesis. Antibiotic DC 81 can recognize and bind to specific sequences of DNA and form a labile covalent adduct .

HY-132243

NFAT Inhibitor-3	Nuclear Factor of activated T Cells (NFAT)	Inflammation/Immunology
NFAT Inhibitor-3 (Compound 10) is a factor nuclear factor of activated T cells (NFAT) inhibitor. NFAT Inhibitor-3 inhibits IL-2 production. NFAT Inhibitor-3 binds in a sequence-selective manner directly to DNA. NFAT Inhibitor-3 can be used for the research of transcription factor dysregulation .

HY-15435

CHAPS 3 Publications Verification	Biochemical Assay Reagents	Others
CHAPS is a non-covalent reversible stabilizer of nucleosomes derived from cholic acid (HY-N0324). CHAPS can stabilize the ultrastructure of nucleosomes, inhibit the spontaneous dissociation of nucleosomes at low concentrations, and maintain the integrity of the basic structural units of chromatin. CHAPS can promote the sliding of histone cores along the DNA chain and reduce sequence-specific binding. CHAPS can also be used as a zwitterionic detergent to dissolve membrane proteins, stabilize various protein-DNA complexes, and retain the biochemical activity of proteins in solution .

HY-15435A

CHAPS hydrate 3 Publications Verification	Biochemical Assay Reagents	Others
CHAPS hydrate is a non-covalent reversible stabilizer of nucleosomes derived from Cholic Acid (HY-N0324). CHAPS hydrate can stabilize the ultrastructure of nucleosomes, inhibit the spontaneous dissociation of nucleosomes at low concentrations, and maintain the integrity of the basic structural units of chromatin. CHAPS hydrate can promote the sliding of histone cores along the DNA chain and reduce sequence-specific binding. CHAPS hydrate can also be used as a zwitterionic detergent to dissolve membrane proteins, stabilize various protein-DNA complexes, and retain the biochemical activity of proteins in solution .

HY-W040129

Chromomycin A3 1 Publications Verification	DNA Alkylator/Crosslinker DNA/RNA Synthesis Apoptosis Caspase	Infection Neurological Disease Cancer
Chromomycin A3 is an inhibitor that selectively binds to GC-rich DNA sequences. Chromomycin A3 targets the DNA minor groove after forming a dimer with Mg ²⁺. Chromomycin A3 inhibits DNA replication and transcription, blocks the binding of Sp1 transcription factor to target gene promoters, downregulates the expression of anti-apoptotic proteins such as FLIP, Mcl-1, and XIAP, and induces S-phase cycle arrest and caspase-dependent apoptosis in tumor cells. Chromomycin A3 can antagonize oxidative stress induced by glutathione depletion and neuronal apoptosis induced by Camptothecin (HY-15660). Chromomycin A3 can be used in basic research on malignant tumors such as cholangiocarcinoma, and is a potential chemosensitizer and GC-rich region probe .

HY-130670

CGP 54626A free base	GABA Receptor	Neurological Disease
CGP 54626A (free base) is a GABAB receptor modulator, which is essential in the central and peripheral nervous systems. It is used as a tool to identify and characterize GABAB receptor agonists and antagonists, which will aid in the development of drugs targeting diseases related to these systems. This discovery involves purified GABAB receptors, receptor proteins and their encoding nucleic acids, facilitating the study of new members of the GABAB receptor family through DNA cloning technology and sequence-derived probes .

HY-E70400

Thermostable T7 RNA Polymerase	DNA/RNA Synthesis	Others
Thermostable T7 RNA Polymerase is a thermostable version of T7 RNA Polymerase (HY-E70090). Compared with T7 RNA Polymerase, it has high temperature resistance and stable activity. T7 RNA polymerase is a polymerase expressed by Escherichia coli from the RNA polymerase gene of T7 bacteriophage. T7 RNA polymerase is highly specific and involved in in vitro transcription (IVT) of mRNA. In the presence of Mg ²⁺, T7 RNA polymerase only uses the single-stranded or double-stranded DNA containing the T7 promoter sequence as a template, and uses NTP as a substrate to synthesize RNA complementary to the single-stranded DNA downstream of the promoter .

Cat. No.	Product Name

HY-L005

Epigenetics Compound Library

1,630 compounds

Epigenetics refers to changes in phenotype that are not rooted in DNA sequence. Many types of epigenetic processes have been identified, including DNA methylation, alteration in the structure of histone proteins and gene regulation by small noncoding microRNAs. Modification of DNA, protein, or RNA, resulting in changes to the function and/or regulation of these molecules, without altering their primary sequences, reveals the complexities of cellular differentiation, embryology, the regulation of gene expression, aging, cancer, and other diseases.

MCE provide a unique collection of 1,630 epigenetics-related compounds that can be used in the research of the related diseases.

HY-L203

Methylation Compound Library

304 compounds

Methylation is an epigenetic modification mechanism that involves adding methyl groups to molecules such as DNA and histones, which can alter gene expression without changing the DNA sequence. This process is catalyzed by enzymes such as DNA methyltransferases (DNMTs) and histone methyltransferases (HMTs), and can be reversed by demethylases. The balance of methylation and demethylation is crucial for maintaining cellular function and genomic stability. Abnormal regulation of methylation may lead to a variety of diseases, including cancer, neurological disorders, and developmental abnormalities. A deep understanding of the molecular mechanisms of methylation metabolism is essential for developing therapeutic strategies for diseases associated with methylation dysregulation.

MCE contains 304 compounds targeting methylation/demethylation enzymes, which is of significant value for studying the pathways of methylation metabolism and exploring their mechanisms of action in diseases.

Cat. No.	Product Name	Type

HY-D1180

DTTCI 3,3′-Diethylthiatricarbocyanine iodide	Dyes
DTTCI (3,3′-Diethylthiatricarbocyanine iodide) is an infrared photographic sensitizing dye. DTTCI is a highly sensitive chiroptical reporter of **DNA helicity and sequence** .

Cat. No.	Product Name	Type

HY-15435A

CHAPS hydrate

3 Publications Verification

Surfactants

CHAPS hydrate is a non-covalent reversible stabilizer of nucleosomes derived from Cholic Acid (HY-N0324). CHAPS hydrate can stabilize the ultrastructure of nucleosomes, inhibit the spontaneous dissociation of nucleosomes at low concentrations, and maintain the integrity of the basic structural units of chromatin. CHAPS hydrate can promote the sliding of histone cores along the DNA chain and reduce sequence-specific binding. CHAPS hydrate can also be used as a zwitterionic detergent to dissolve membrane proteins, stabilize various protein-DNA complexes, and retain the biochemical activity of proteins in solution .

HY-W001952

6-Bromo-2-naphthol

Biochemical Assay Reagents

6-Bromo-2-naphthol is an RTP (real-time polymerase chain reaction) probe that forms a 1:1 or 2:1 complex with β-cyclodextrin (β-CD). 6-Bromo-2-naphthol is capable of real-time monitoring of PCR reactions and quantification of specific nucleic acid sequences. RTP probes are a class of small DNA or RNA sequences labeled with fluorescent dyes and quencher molecules, which can be widely used in gene expression analysis, SNP genotyping, and pathogen detection. 6-Bromo-2-naphthol embeds into the cyclodextrin cavity through hydrophobic interactions, inhibits the oxygen quenching effect, and emits a phosphorescent signal at room temperature. 6-Bromo-2-naphthol can also be used as an intermediate for the synthesis of antibacterial azo dyes, and its derivatives show antibacterial activity against Staphylococcus aureus, Escherichia coli and other bacteria .

Cat. No.	Product Name	Target	Research Area

HY-P1310

VKGILS-NH2 1 Publications Verification	Protease Activated Receptor (PAR)	Inflammation/Immunology
VKGILS-NH2 is a reversed amino acid sequence control peptide for SLIGKV-NH2 (protease-activated receptor 2 (PAR2) agonist). VKGILS-NH2 has no effect on DNA synthesis in cells .

HY-P5429

DNA-PK Substrate	Peptides	Others
DNA-PK Substrate is a biological active peptide. (A substrate for DNA-dependent protein kinase (DNA-PK), phosphorylation. DNA-PK is essential for the repair of DNA double-strand breaks. This peptide corresponding to 11–24 amino acids of human p53 with threonine 18 and serine 20 changed to alanine is used as a substrate for the assay of DNA-PK activityPyroglutamyl (pGlu) peptides may spontaneously form when either Glutamine (Q) or Glutamic acid (E) is located at the sequence N-terminus. The conversion of Q or E to pGlu is a natural occurrence and in general it is believed that the hydrophobic γ-lactam ring of pGlu may play a role in peptide stability against gastrointestinal proteases. Pyroglutamyl peptides are therefore considered a normal subset of such peptides and are included as part of the peptide purity during HPLC analysis.)

HY-P1286

PKC β pseudosubstrate	PKC	Neurological Disease
PKC β pseudosubstrate is a selective cell-permeable inhibitor of PKC .

HY-106262B

Delcasertib hydrochloride 3 Publications Verification KAI-9803 hydrochloride; BMS-875944 hydrochloride	PKC	Cardiovascular Disease Inflammation/Immunology
Delcasertib (KAI-9803) hydrochloride is a potent and selective δ-protein kinase C (δPKC) inhibitor. Delcasertib (KAI-9803) hydrochloride could ameliorate injury associated with ischemia and reperfusion in animal models of acute myocardial infarction (MI) .

HY-P5343

p53 CBS p53 Consensus binding sequence	MDM-2/p53	Others
p53 CBS (p53 Consensus binding sequence) is a biological active peptide. (p53 consensus DNA binding site)

HY-P1781

Peptide C105Y	Peptides	Cancer
Peptide C105Y, a synthetic and cell-penetrating peptide based on the amino acid sequence corresponding to residues 359-374 of α1-antitrypsin, enhances gene expression from DNA nanoparticles .

HY-P1781A

Peptide C105Y TFA	Secretin Receptor	Cancer
Peptide C105Y TFA, a synthetic and cell-penetrating peptide based on the amino acid sequence corresponding to residues 359-374 of α1-antitrypsin, enhances gene expression from DNA nanoparticles .

HY-P1310A

VKGILS-NH2 TFA	Protease Activated Receptor (PAR)	Inflammation/Immunology
VKGILS-NH2 TFA is a reversed amino acid sequence control peptide for SLIGKV-NH2 (protease-activated receptor 2 (PAR2) agonist). VKGILS-NH2 TFA has no effect on DNA synthesis in cells .

HY-P1286A

PKC β pseudosubstrate TFA	PKC	Neurological Disease
PKC β pseudosubstrate TFA is a selective cell-permeable inhibitor of PKC .

HY-106262

Delcasertib KAI-9803; BMS-875944	PKC	Cardiovascular Disease Inflammation/Immunology
Delcasertib (KAI-9803) is a potent and selective δ-protein kinase C (δPKC) inhibitor. Delcasertib (KAI-9803) could ameliorate injury associated with ischemia and reperfusion in animal models of acute myocardial infarction (MI) .

HY-P1103

CTCE-9908 1 Publications Verification	CXCR	Cancer
CTCE-9908 is a potent and selective CXCR4 antagonist. CTCE-9908 induces mitotic catastrophe, cytotoxicity and inhibits migration in CXCR4-expressing ovarian cancer cells .

HY-P1103A

CTCE-9908 TFA	CXCR	Cancer
CTCE-9908 TFA is a potent and selective CXCR4 antagonist. CTCE-9908 TFA induces mitotic catastrophe, cytotoxicity and inhibits migration in CXCR4-expressing ovarian cancer cells .

HY-P1321

GR231118 1229U91; GW1229	Neuropeptide Y Receptor	Neurological Disease
GR231118, an analogue of the C-terminus of neuropeptide Y, is a potent , competitive and relative seletive antagonist at human neuropeptide Y Y receptor with a pK_i of 10.4. GR231118 a potent agonist at the human neuropeptide Y Y4 receptor (pEC₅₀=8.6; pK_i=9.6) and a weak agonist at the human and rat neuropeptide YY2 and Y5 receptors. GR231118 also has high affinity for the mouse neuropeptide Y Y6 receptor (pK_i= 8.8) .

HY-P1321A

GR231118 TFA 1229U91 TFA; GW1229 TFA	Neuropeptide Y Receptor	Neurological Disease
GR231118 TFA, an analogue of the C-terminus of neuropeptide Y, is a potent , competitive and relative seletive antagonist at human neuropeptide YY receptor with a pK_i of 10.4. GR231118 a potent agonist at the human neuropeptide YY4 receptor (pEC₅₀=8.6; pK_i=9.6) and a weak agonist at the human and rat neuropeptide Y Y2 and Y5 receptors. GR231118 also has high affinity for the mouse neuropeptide YY6 receptor (pK_i= 8.8) .

HY-P3215A

Oxytocin parallel dimer TFA	Oxytocin Receptor	Endocrinology
Oxytocin parallel dimer TFA is the disulfide-bridged homo peptide dimer. Oxytocin dimer has oxytocin and vasopressin-like activity with less toxic than oxytocin .

HY-P3222A

Oxytocin antiparallel dimer TFA	Peptides	Endocrinology
Oxytocin antiparallel dimer TFA is the disulfide-bridged homo peptide dimer. Oxytocin dimer has oxytocin and vasopressin-like activity with less toxic than oxytocin .

HY-P3222

Oxytocin antiparallel dimer	Peptides	Endocrinology
Oxytocin antiparallel dimer is the disulfide-bridged homo peptide dimer. Oxytocin dimer has oxytocin and vasopressin-like activity with less toxic than oxytocin .

HY-P3215

Oxytocin parallel dimer	Oxytocin Receptor	Endocrinology
Oxytocin parallel dimer is the disulfide-bridged homo peptide dimer. Oxytocin dimer has oxytocin and vasopressin-like activity with less toxic than oxytocin .

Cat. No.	Product Name	Category	Target	Chemical Structure

HY-W040129

Chromomycin A3 1 Publications Verification	Microorganisms Source classification	DNA Alkylator/Crosslinker DNA/RNA Synthesis Apoptosis Caspase
Chromomycin A3 is an inhibitor that selectively binds to GC-rich DNA sequences. Chromomycin A3 targets the DNA minor groove after forming a dimer with Mg ²⁺. Chromomycin A3 inhibits DNA replication and transcription, blocks the binding of Sp1 transcription factor to target gene promoters, downregulates the expression of anti-apoptotic proteins such as FLIP, Mcl-1, and XIAP, and induces S-phase cycle arrest and caspase-dependent apoptosis in tumor cells. Chromomycin A3 can antagonize oxidative stress induced by glutathione depletion and neuronal apoptosis induced by Camptothecin (HY-15660). Chromomycin A3 can be used in basic research on malignant tumors such as cholangiocarcinoma, and is a potential chemosensitizer and GC-rich region probe .

HY-N2187

Deoxyshikonin 2 Publications Verification	Infection Cardiovascular Disease Quinones Structural Classification Classification of Application Fields Plants Naphthalene Quinones Boraginaceae Disease Research Fields Arnebia euchroma (Royle) Johnst.	Bacterial HIF/HIF Prolyl-Hydroxylase PI3K Apoptosis
Deoxyshikonin increases the expression of VEGF-C and VEGF-A mRNA in HMVEC-dLy, promotes HIF-1α and HIF-1β subunit interaction and binds to specific DNA sequences targeted by HIF. Deoxyshikonin inhibited colorectal cancer (CRC) through the PI3K/Akt/mTOR pathway. Deoxyshikonin has proangiogenesis effect and antitumor activity. Deoxyshikonin is an antibacterial agent against methicillin-resistant S. aureus (MRSA) and S. pneumonia (MIC=17 μg/mL) .

HY-N6181

Terrelumamide A	Alkaloids Human Gut Microbiota Metabolites Microorganisms Classification of Application Fields Source classification Marine natural products Endogenous metabolite Disease Research Fields Marine microorganism Endocrinology	Others
Terrelumamide A is a lumazine-containing peptide. Terrelumamide A is isolated from the culture broth of the marine-derived fungus Aspergillus terreus. Terrelumamide A exhibits pharmacological activity by improving insulin sensitivity. Terrelumamide A has the potential in the application of DNA sequence recognition .

HY-W040129R

Chromomycin A3 (Standard)	Microorganisms Source classification	Reference Standards Bacterial Fungal Apoptosis Antibiotic
Chromomycin A3 (Standard) is the analytical standard of Chromomycin A3 (HY-W040129). This product is intended for research and analytical applications. Chromomycin A3 is an inhibitor that selectively binds to GC-rich DNA sequences. Chromomycin A3 targets the DNA minor groove after forming a dimer with Mg ²⁺. Chromomycin A3 inhibits DNA replication and transcription, blocks the binding of Sp1 transcription factor to target gene promoters, downregulates the expression of anti-apoptotic proteins such as FLIP, Mcl-1, and XIAP, and induces S-phase cycle arrest and caspase-dependent apoptosis in tumor cells. Chromomycin A3 can antagonize oxidative stress induced by glutathione depletion and neuronal apoptosis induced by Camptothecin (HY-15660). Chromomycin A3 can be used in basic research on malignant tumors such as cholangiocarcinoma, and is a potential chemosensitizer and GC-rich region probe .

Cat. No.	Compare	Product Name	Application	Reactivity

HY-P81409

	SATB1 Antibody (YA1154) DNA-binding protein SATB1 (Special AT-rich sequence-binding protein 1)	IHC-P	Human
	SATB1 Antibody (YA1154) is a rabbit-derived non-conjugated IgG antibody (Clone NO.: YA1154), targeting SATB1. SATB1 Antibody (YA1154) can be used for IHC-P experiment in human background.

Compare Products


Products	In-stock - + Add to Cart
Cat. No.
Host
Reactivity
Application
Dilution Ratio
Molecular Weight
Conjugation
Clonality
Immunogen
Appearance
Isotype
Gene ID
SwissProt ID
Purity
Formulation
Free Sample	Yes No
Size	* This product has been "discontinued". Optimized version of product available: / In-stock - + Add to Cart Get quote

Cat. No.	Product Name		Classification

HY-150729A

ODN 1982 sodium		CpG ODNs
ODN 1982 sodium is a unmethylated oligodeoxyribonucleotide (ODN) with no CpG motif, and can be used to prepare DNA vaccines. ODN 1982 sodium inhibits R-848 signaling. ODN 1982 sequence: 5’-tccaggacttctctcaggtt-3’ .

HY-147217

Bepirovirsen ISIS 505358		Antisense Oligonucleotides
Bepirovirsen is an antisense oligonucleotide targeting all HBV messenger RNAs. Bepirovirsen leads to reductions in HBV-derived RNAs, HBV DNA and viral proteins. Bepirovirsen can be used for the research of chronic HBV infection. Bepirovirsen binding site sequence (GCACTTCGCTTCACCTCTGC) .

HY-147217A

Bepirovirsen sodium ISIS 505358 sodium		Antisense Oligonucleotides
Bepirovirsen (ISIS 505358) sodium is an antisense oligonucleotide targeting all HBV messenger RNAs. Bepirovirsen sodium leads to reductions in HBV-derived RNAs, HBV DNA and viral proteins. Bepirovirsen sodium can be used for the research of chronic HBV infection. Bepirovirsen sodium binding site sequence (GCACTTCGCTTCACCTCTGC) .

HY-W406070

2'-O,4'-C-Methyleneguanosine LNA-G		Nucleosides and their Analogs G
2′-O,4′-C-Methyleneguanosine (LNA-G) is a reverse guanine analog, where LNA (locked nucleic acid) is a nucleic acid analog. LNA modification can be widely used in various fields, such as effective binding affinity with complementary sequences and stronger nuclease resistance than natural nucleotides, providing great potential for application in disease diagnosis and research. LNA-G can also be incorporated into the DNA chain by KOD DNA polymerase .

HY-112858

dSPACER		Nucleoside Phosphoramidites
dSPACER is a compound for the phosphoramidite synthesis of oligonucleotides and the creation of the abasic step in the oligonucleotide sequence.Abasic phosphoramidites are used in DNA and oligonucleotide synthesis.

HY-153494A

Rosomidnar sodium PNT100 sodium		Antisense Oligonucleotides
PNT100 sodium is a 24-base, chemically unmodified DNA oligonucleotide sequence that is complementary to the regulatory region upstream of the BCL-2 gene. Exposure of tumor cells to PNT100 results in suppression of proliferation and cell death.

HY-153494

Rosomidnar PNT100		Antisense Oligonucleotides
PNT100 is a 24-base, chemically unmodified DNA oligonucleotide sequence that is complementary to the regulatory region upstream of the BCL-2 gene. Exposure of tumor cells to PNT100 results in suppression of proliferation and cell death.

HY-150729

ODN 1982		CpG ODNs
ODN 1982 is a unmethylated oligodeoxyribonucleotide (ODN) with no CpG motif, can be used to prepare DNA vaccines. ODN 1982 inhibits R-848 signaling. ODN 1982 sequence: 5’-tccaggacttctctcaggtt-3’ .

HY-150214

ODN MT01		CpG ODNs
ODN MT01 was designed based on human mitochondrial DNA sequences, which is an inhibitory ODN that promotes osteocyte differentiation. ODN MT01 could promote osteoblast maturation and activation in rats, reduce rat alveolar bone absorption caused by periodontitis, regulate the expression levels of osteogenesis-related factors.

HY-150214A

ODN MT 01 sodium		CpG ODNs
ODN MT01 sodium was designed based on human mitochondrial DNA sequences, which is an inhibitory ODN that promotes osteocyte differentiation. ODN MT01 sodium could promote osteoblast maturation and activation in rats, reduce rat alveolar bone absorption caused by periodontitis, regulate the expression levels of osteogenesis-related factors.

HY-150751

ODN TTAGGG 1 Publications Verification ODN A151		CpG ODNs
ODN TTAGGG (A151), inhibitory oligonucleotide (ODN), is a TLR9, AIM2 and cGAS antagonist. ODN TTAGGG is immunosuppressive and inhibits AIM2 inflammasome activation, as well as cGAS activation, by competing with DNA. ODN TTAGGG can be used in the study of lupus erythematosus and other related autoimmune diseases. ODN TTAGGG sequence: 5'-T-T-A-G-G-G-T-T-A-G-G-G-T-T-A-G-G-G-T-T-A-G-G-G-3' .

HY-150751C

ODN TTAGGG sodium 1 Publications Verification ODN A151 sodium		CpG ODNs
ODN TTAGGG sodium, inhibitory oligonucleotide (ODN), is a TLR9, AIM2 and cGAS antagonist. ODN TTAGGG sodium is immunosuppressive and inhibits AIM2 inflammasome activation, as well as cGAS activation, by competing with DNA. ODN TTAGGG sodium can be used in the study of lupus erythematosus and other related autoimmune diseases. ODN TTAGGG sequence: 5'-T-T-A-G-G-G-T-T-A-G-G-G-T-T-A-G-G-G-T-T-A-G-G-G-3' .

Inquiry Online

Your information is safe with us. * Required Fields.

MCE Japan Authorized Agent ナミキ商事株式会社コスモ・バイオ株式会社重松貿易株式会社
Salutation			Country or Region *
Applicant Name *			Organization Name *
Department *
Email Address *			Product Name *
Cat. No.			Requested quantity *
Phone Number *
Remarks

Inquiry Online

Inquiry Information

Product Name:
Cat. No.:
Quantity:
MCE Japan Authorized Agent:

DNA sequence

Inhibitors & Agonists

Screening Libraries

Fluorescent Dye

Biochemical Assay Reagents

Peptides

NaturalProducts

Antibodies

Oligonucleotides

Natural
Products