2. Infection

Infection

Infection

Related Products

PDF 70.44 MB

Infection is a pathophysiological process that involves the invasion and colonization of a living organism (host) by disease-causing infectious agents, the reaction of host tissues to these agents and the toxins they produce, and the transmission of infectious agents to other hosts. Common infectious agents include viruses, viroids, prions, bacteria, nematodes, arthropods, and other macroparasites such as tapeworms. Hosts can fight infections using their immune system. Mammals often engage both innate and adaptive immune systems to eliminate infectious agents or inhibit their growth and transmission. When infection occurs, anti-infective drugs can suppress the infection. Several broad types of anti-infective drugs exist, depending on the type of organism targeted; they include antibacterial (antibiotic), antiviral, antifungal and antiparasitic agents.

Cat. No. Product Name CAS No. Purity Chemical Structure
  • HY-W010155R
    Tryptophol (Standard) 526-55-6 99.84%
    Tryptophol (Standard) (Indole-3-ethanol (Standard)) is an analytical standard of Tryptophol (HY-W010155). This product is intended for use in research and analytical applications.Tryptophol is an aromatic alcohol and secondary metabolite produced by microorganisms. Tryptophol induces Apoptosis and cleavage of caspase-8. Tryptophol inhibits Cunninghamella blakesleeana biofilm. Tryptophol has anti-phage infection, biofilm formation regulation, anti-inflammatory, hemolytic, sleep induction, temperature change, seizure susceptibility and immune regulation activities. Tryptophol is used in the research of African trypanosomiasis, sleep disorders, epilepsy.
    Tryptophol (Standard)
  • HY-W017162R
    DL-3-Phenyllactic acid (Standard) 828-01-3 99.93%
    DL-3-Phenyllactic acid (Standard) is the analytical standard of DL-3-Phenyllactic acid. This product is intended for research and analytical applications. DL-3-Phenyllactic acid is a broad-spectrum antimicrobial compound.
    DL-3-Phenyllactic acid (Standard)
  • HY-Y0479AS2
    L-Lactate-13C sodium (20% in water) 201595-69-9 98.00%
    L-Lactate-13C ((S)-2-Hydroxypropanoic acid-13C) sodium is the 13C-labeled L-Lactic acid sodium (HY-W040233). L-lactate Sodium is a buildiing block which can be used as a precursor for the production of the bioplastic polymer poly-lactic acid. L-Lactic acid Sodium has antiproliferative activity.
    L-Lactate-13C sodium (20% in water)
  • HY-132280
    Tirilazad 110101-66-1 98.11%
    Tirilazad is a nonglucocorticoid, 21-aminosteroid that inhibits lipid peroxidation. Tirilazad can attenuate brain or spinal cord injury caused by trauma, stroke, ischemia and reperfusion injury. Tirilazad has antiviral activities against nCoV. Tirilazad is neuroprotective for ischaemic stroke, can be used for subarachnoid hemorrhage research.
    Tirilazad
  • HY-13207A
    ONX-0914 TFA 98.01%
    ONX-0914 (PR-957) TFA is a selective inhibitor of low-molecular mass polypeptide-7 (LMP7), the chymotrypsin-like subunit of the immunoproteasome. ONX-0914 TFA blocks cytokine production and attenuates progression of experimental arthritis. ONX-0914 TFA is a noncompetitive irreversible inhibitor of the mycobacterial proteasome (Ki=5.2 μM). ONX-0914 TFA reactivates latent HIV-1 through p-TEFb activation mediated by HSF-1.
    ONX-0914 TFA
  • HY-145119AS
    Mindeudesivir hydrobromide 2779498-79-0 98.16%
    Mindeudesivir (JT001; VV116; GS-621763-d1) hydrobromide is a deuterated version of Remdesivir (HY-104077), a highly orally active nucleoside antiviral against SARS-CoV-2 and respiratory syncytial virus (RSV). Mindeudesivir hydrobromide retains the antiviral activity of Remdesivir against COVID-19, and is the first domestically produced deuterium targeting the COVID-19.
    Mindeudesivir hydrobromide
  • HY-10244
    MK-0608 443642-29-3 99.81%
    MK-0608 is a potent and orally bioavailable inhibitor of HCV replication in vitro with an EC50 of 0.3 μM (EC90=1.3 μM) in the subgenomic-replicon assay.
    MK-0608
  • HY-18595
    BI 224436 1155419-89-8 99.74%
    BI 224436 is a novel HIV-1 noncatalytic site integrase inhibitor with EC50 values of less than 15 nM against different HIV-1 laboratory strains.
    BI 224436
  • HY-10574A
    Rilpivirine hydrochloride 700361-47-3 99.81%
    Rilpivirine (R278474) hydrochloride is a potent and specific diarylpyrimidine (DAPY) non-nucleoside reverse transcriptase inhibitor (NNRTI). Rilpivirine hydrochloride has high antiviral activity against wild-type HIV (EC50=0.4 nM) and mutant viruses (EC50=0.1-2.0 nM). Rilpivirine hydrochloride has a high genetic barrier to resistance development of HIV.
    Rilpivirine hydrochloride
  • HY-109168
    Bersacapavir 1638266-40-6 99.24%
    Bersacapavir (JNJ-6379) is a novel Hepatitis B Virus capsid assembly modulator. Bersacapavir interferes with the assembly process of the hepatitis B virus nucleocapsid by binding to the hydrophobic pocket at the dimer-dimer interface of hepatitis B core protein (HBc) subunits. Bersacapavir inhibits the replication of HBV. Bersacapavir is mainly used in the research of chronic hepatitis B.
    Bersacapavir
  • HY-126130
    LysRs-IN-2 2170696-76-9 99.92%
    LysRs-IN-2 is a lysyl-tRNA synthetase (KRS) inhibitor with IC50s of 0.015 μM and 0.13 μM for Plasmodium falciparum lysyl-tRNA synthetase (PfKRS) and Cryptosporidium parvum lysyl-tRNA synthetase (CpKRS), respectively.
    LysRs-IN-2
  • HY-147217
    Bepirovirsen 1403787-62-1 98.44%
    Bepirovirsen is an antisense oligonucleotide targeting all HBV messenger RNAs. Bepirovirsen leads to reductions in HBV-derived RNAs, HBV DNA and viral proteins. Bepirovirsen can be used for the research of chronic HBV infection. Bepirovirsen binding site sequence (GCACTTCGCTTCACCTCTGC).
    Bepirovirsen
  • HY-147411
    Ulonivirine 1591823-76-5 98.61%
    Ulonivirine (MK-8507) is an orally active non-nucleoside reverse transcriptase inhibitor with high antiviral activity. Ulonivirine can be used for the research of HIV-1 infection.
    Ulonivirine
  • HY-P0052A
    Enfuvirtide acetate 914454-00-5 99.95%
    Enfuvirtide (T20; DP178) acetate is an anti-HIV-1 fusion inhibitor peptide.
    Enfuvirtide acetate
  • HY-P99337
    Ansuvimab 2375952-29-5 99.90%
    Ansuvimab (Ansuvimab-zyk) is a recombinant human monoclonal IgG1 antibody that exhibits antiviral activity against Zaire ebolavirus. Ansuvimab binds to the glycoprotein on Zaire ebolavirus to block its entry into host cells.
    Ansuvimab
  • HY-P99583
    Suvratoxumab 1629620-18-3 98.79%
    Suvratoxumab (MEDI4893) is a long-acting, high-affinity human anti-α-toxin monoclonal antibody (IgG1κ type). Suvratoxumab potently neutralizes α-toxin, a key S. aureus virulence factor. Suvratoxumab improves survival and reduces lung injury in an immunocompromised mice model of pneumonia. Suvratoxumab also enhances the antibacterial activity of Vancomycin (HY-B0671) or Linezolid (HY-10394).
    Suvratoxumab
  • HY-106574A
    Ceftobiprole medocaril sodium 252188-71-9
    Ceftobiprole medocaril (BAL5788) sodium is the parenteral proagent of Ceftobiprole (HY-112579). Ceftobiprole is a parenteral pyrrolidinone cephalosporin. Ceftobiprole is a broad-spectrum cephalosporin with high levels of in vitro activity against methicillin- (MRSA) and vancomycin-resistant staphylococci (VRSA) and penicillin-resistant streptococci. Ceftobiprole also inhibits gram-positive and gram-negative pathogens.
    Ceftobiprole medocaril sodium
  • HY-14655S
    Sulfasalazine-d4 1346606-50-5 ≥99.0%
    Sulfasalazine-d4 is the deuterium labeled Sulfasalazine. Sulfasalazine (NSC 667219) is an anti-rheumatic agent for the research of rheumatoid arthritis and ulcerative colitis. Sulfasalazine can suppress NF-κB activity. Sulfasalazine is a type 1 ferroptosis inducer.
    Sulfasalazine-d4
  • HY-B0101S
    Fluconazole-d4 1124197-58-5 99.66%
    Fluconazole-d4 is the deuterium labeled Fluconazole. Fluconazole (UK-49858) is a triazole antifungal agent with excellent activities against a broad range of fungi, especially against Candida albicans. Fluconazole inhibits C. albicans and Candida kefyr with IC99s range from 0.20 μg/mL to 0.39 μg/mL.
    Fluconazole-d4
  • HY-B0329S
    Isoniazid-d4 774596-24-6 99.86%
    Isoniazid-d4 is the deuterium labeled Isoniazid. Isoniazid (INH) is a proagent and must be activated by a bacterial catalase-peroxidase enzyme KatG. Isoniazid is bactericidal to rapidly dividing mycobacteria and has anti-tuberculostatic activity.
    Isoniazid-d4
Cat. No. Product Name / Synonyms Application Reactivity