Search Result
Results for "
Methoxyethyl
" in MedChemExpress (MCE) Product Catalog:
3
Biochemical Assay Reagents
6
Isotope-Labeled Compounds
Cat. No. |
Product Name |
Target |
Research Areas |
Chemical Structure |
-
- HY-W048495
-
|
Nucleoside Antimetabolite/Analog
|
Cancer
|
2'-O-(2-Methoxyethyl)-uridine is a synthetic oligonucleotide conversed from uridine. 2'-O-(2-Methoxyethyl)-uridine has the potential for chemotherapeutic agents development .
|
-
-
- HY-132579
-
RG6042; IONIS-HTTRx
|
Huntingtin
|
Neurological Disease
|
Tominersen (RG6042) is a second-generation 2′-O-(2-methoxyethyl) antisense oligonucleotide that targets huntingtin protein (HTT) mRNA and potently suppresses HTT production. Tominersen improves survival and reduces brain atrophy in mice. Tominersen can be used for the research of Huntington’s disease (HD) .
|
-
-
- HY-W048496
-
|
Nucleoside Antimetabolite/Analog
|
Cancer
|
2'-O-(2-Methoxyethyl)-cytidine is a synthetic oligonucleotide derived from uridine. 2'-O-(2-Methoxyethyl)-cytidine has good hybridization properties and high stability, and can be used in the research of oligonucleotide chemotherapeutic agents .
|
-
-
- HY-W013849S
-
-
-
- HY-154285
-
|
Nucleoside Antimetabolite/Analog
|
Cancer
|
3’-O-(2-Methoxyethyl) uridine is a uridine analog. Uridine has potential antiepileptic effects, and its analogs can be used to study anticonvulsant and anxiolytic activities, as well as to develop new antihypertensive agents .
|
-
-
- HY-152516
-
|
Nucleoside Antimetabolite/Analog
|
Cancer
|
2’-O-(2-Methoxyethyl) inosine is a purine nucleoside analog. Purine nucleoside analogs have broad antitumor activity targeting indolent lymphoid malignancies. Anticancer mechanisms in this process rely on inhibition of DNA synthesis, induction of apoptosis, etc .
|
-
-
- HY-152577
-
|
Nucleoside Antimetabolite/Analog
|
Cancer
|
3’-O-(2-Methoxyethyl) inosine is a purine nucleoside analog. Purine nucleoside analogs have broad antitumor activity targeting indolent lymphoid malignancies. Anticancer mechanisms in this process rely on inhibition of DNA synthesis, induction of apoptosis, etc .
|
-
-
- HY-154434
-
|
Nucleoside Antimetabolite/Analog
|
Cancer
|
3’-O-(2-Methoxyethyl)-5-methyluridine is a thymidine analog. Analogs of this series have insertional activity towards replicated DNA. They can be used to label cells and track DNA synthesis .
|
-
-
- HY-152480
-
|
Nucleoside Antimetabolite/Analog
|
Cancer
|
3’-O-(2-Methoxyethyl)-5-methylcytidine is a cytidine analog. Cytidine analogs have a mechanism of inhibiting DNA methyltransferases (such as Zebularine, HY-13420), and have potential anti-metabolic and anti-tumor activities .
|
-
-
- HY-42084R
-
p-Hydroxyphenethyl methyl ether (Standard)
|
Biochemical Assay Reagents
Reference Standards
|
Others
|
4-(2-Methoxyethyl)phenol (Standard) is the analytical standard of 4-(2-Methoxyethyl)phenol. This product is intended for research and analytical applications. 4-(2-Methoxyethyl)phenol is a biochemical reagent that can be used as a biological material or organic compound for life science related research.
|
-
-
- HY-W033132
-
-
-
- HY-W048491
-
|
DNA/RNA Synthesis
|
Others
|
2′-O-(2-Methoxyethyl)adenosine is a compound can be used in the synthesis of oligonucleotides .
|
-
-
- HY-152482
-
|
Nucleoside Antimetabolite/Analog
|
Cancer
|
3’-O-(2-Methoxyethyl)-2-thiouridine is a purine nucleoside analog. Purine nucleoside analogs have broad antitumor activity targeting indolent lymphoid malignancies. Anticancer mechanisms in this process rely on inhibition of DNA synthesis, induction of apoptosis, etc .
|
-
-
- HY-152549
-
|
Nucleoside Antimetabolite/Analog
|
Others
|
2’-O-(2-Methoxyethyl)-2-aminoadenosine is a purine nucleoside analogue. Purine nucleoside analogs have broad antitumor activity targeting indolent lymphoid malignancies. Anticancer mechanisms in this process rely on inhibition of DNA synthesis, induction of apoptosis, etc .
|
-
-
- HY-N1871
-
|
Others
|
Inflammation/Immunology
|
4-(2-Hydroxy-1-methoxyethyl)-1,2-benzenediol is a phenylethanoid isolated from the stem bark of Syringa reticulate (Bl.) Hara (Oleaceae) with expectorant and antiasthmatic activity .
|
-
-
- HY-23789
-
2'-O-MOE-rG
|
Nucleoside Antimetabolite/Analog
DNA/RNA Synthesis
|
Others
|
2′-O-(2-Methoxyethyl)guanosine (2'-O-MOE-rG) is a 2'-O-methoxyethyl-modified nucleoside analogue and an important intermediate in the synthesis of nucleic acid drugs. 2′-O-(2-Methoxyethyl)guanosine neither effectively phosphorylated by cytosolic nucleoside kinases, nor are they incorporated into cellular DNA or RNA .
|
-
-
- HY-152646
-
|
Nucleoside Antimetabolite/Analog
|
Cancer
|
3’-O-(2-Methoxyethyl)-2-aminoadenosine is an adenosine analog. Adenosine analogs mostly act as smooth muscle vasodilators and have also been shown to inhibit cancer progression. Its popular products are adenosine phosphate, Acadesine (HY-13417), Clofarabine (HY-A0005), Fludarabine phosphate (HY-B0028) and Vidarabine (HY-B0277) .
|
-
-
- HY-152573
-
|
Nucleoside Antimetabolite/Analog
|
Cancer
|
N1-Methyl-3’-O-(2-methoxyethyl) adenosine is a purine nucleoside analog. Purine nucleoside analogs have broad antitumor activity targeting indolent lymphoid malignancies. Anticancer mechanisms in this process rely on inhibition of DNA synthesis, induction of apoptosis, etc .
|
-
-
- HY-152571
-
|
Nucleoside Antimetabolite/Analog
|
Cancer
|
N1-Methyl-2’-O-(2-methoxyethyl) inosine is a purine nucleoside analog. Purine nucleoside analogs have broad antitumor activity targeting indolent lymphoid malignancies. Anticancer mechanisms in this process rely on inhibition of DNA synthesis, induction of apoptosis, etc .
|
-
-
- HY-152575
-
|
Nucleoside Antimetabolite/Analog
|
Cancer
|
N6-Methyl-3’-O-(2-methoxyethyl) adenosine is a purine nucleoside analog. Purine nucleoside analogs have broad antitumor activity targeting indolent lymphoid malignancies. Anticancer mechanisms in this process rely on inhibition of DNA synthesis, induction of apoptosis, etc .
|
-
-
- HY-152569
-
|
Nucleoside Antimetabolite/Analog
|
Cancer
|
N1-Methyl-2’-O-(2-methoxyethyl) adenosine is a purine nucleoside analog. Purine nucleoside analogs have broad antitumor activity targeting indolent lymphoid malignancies. Anticancer mechanisms in this process rely on inhibition of DNA synthesis, induction of apoptosis, etc .
|
-
-
- HY-152570
-
|
Nucleoside Antimetabolite/Analog
|
Cancer
|
N6-Methyl-2’-O-(2-methoxyethyl) adenosine is a purine nucleoside analog. Purine nucleoside analogs have broad antitumor activity targeting indolent lymphoid malignancies. Anticancer mechanisms in this process rely on inhibition of DNA synthesis, induction of apoptosis, etc .
|
-
-
- HY-152567
-
|
Nucleoside Antimetabolite/Analog
|
Cancer
|
N1-Methyl-2’-O-(2-methoxyethyl) guanosine is a purine nucleoside analog. Purine nucleoside analogs have broad antitumor activity targeting indolent lymphoid malignancies. Anticancer mechanisms in this process rely on inhibition of DNA synthesis, induction of apoptosis, etc .
|
-
-
- HY-152587
-
|
Nucleoside Antimetabolite/Analog
|
Cancer
|
N1-Methyl-3’-O-(2-methoxyethyl) inosine is a purine nucleoside analog. Purine nucleoside analogs have broad antitumor activity targeting indolent lymphoid malignancies. Anticancer mechanisms in this process rely on inhibition of DNA synthesis, induction of apoptosis, etc .
|
-
-
- HY-152568
-
|
Nucleoside Antimetabolite/Analog
|
Cancer
|
N7-Methyl-2’-O-(2-methoxyethyl) guanosine is a purine nucleoside analog. Purine nucleoside analogs have broad antitumor activity targeting indolent lymphoid malignancies. Anticancer mechanisms in this process rely on inhibition of DNA synthesis, induction of apoptosis, etc .
|
-
-
- HY-154173
-
|
Nucleoside Antimetabolite/Analog
|
Cancer
|
3’-O-(t-Butyldimethylsilyl)-2’-O-(2-methoxyethyl) uridine is a uridine analog. Uridine has potential antiepileptic effects, and its analogs can be used to study anticonvulsant and anxiolytic activities, as well as to develop new antihypertensive agents .
|
-
-
- HY-154240
-
|
Nucleoside Antimetabolite/Analog
|
Cancer
|
2-Amino-2’,3’-bis-O-(2-methoxyethyl) adenosine is a purine nucleoside analog. Purine nucleoside analogs have broad antitumor activity targeting indolent lymphoid malignancies. Anticancer mechanisms in this process rely on inhibition of DNA synthesis, induction of apoptosis, etc .
|
-
-
- HY-154385
-
|
Nucleoside Antimetabolite/Analog
|
Cancer
|
4’,5’-Didehydro-2’-O-(2-methoxyethyl)-5-methyluridine is a purine nucleoside analog. Purine nucleoside analogs have broad antitumor activity targeting indolent lymphoid malignancies. Anticancer mechanisms in this process rely on inhibition of DNA synthesis, induction of apoptosis, etc .
|
-
-
- HY-154290
-
|
Nucleoside Antimetabolite/Analog
|
Cancer
|
N3,5-Dimethyl-2’-O-(2-methoxyethyl) uridine is a purine nucleoside analog. Purine nucleoside analogs have broad antitumor activity targeting indolent lymphoid malignancies. Anticancer mechanisms in this process rely on inhibition of DNA synthesis, induction of apoptosis, etc .
|
-
-
- HY-132608
-
ISIS-420915 sodium
|
Transthyretin (TTR)
|
Neurological Disease
|
Inotersen (ISIS-420915) sodium is a 2′-O-methoxyethyl-modified antisense oligonucleotide. Inotersen sodium inhibits the production of transthyretin (TTR) protein by targeting the TTR RNA transcript and reduces the levels of the TTR transcript. Inotersen sodium can be used for the research of hereditary TTR amyloidosis polyneuropathy .
|
-
-
- HY-154449
-
|
Nucleoside Antimetabolite/Analog
|
Cancer
|
N4-Benzoyl-3’-O-(2-methoxyethyl)-5-methylcytidine is a purine nucleoside analog. Purine nucleoside analogs have broad antitumor activity targeting indolent lymphoid malignancies. Anticancer mechanisms in this process rely on inhibition of DNA synthesis, induction of apoptosis, etc .
|
-
-
- HY-42084
-
p-Hydroxyphenethyl methyl ether
|
Biochemical Assay Reagents
|
Others
|
4-(2-Methoxyethyl)phenol is a biochemical reagent that can be used as a biological material or organic compound for life science related research.
|
-
-
- HY-152382
-
|
Nucleoside Antimetabolite/Analog
|
Cancer
|
3’-O-(2-Methoxyethyl)cytidine is a cytidine analog. Cytidine analogs have a mechanism of inhibiting DNA methyltransferases (such as Zebularine, HY-13420), and have potential anti-metabolic and anti-tumor activities .
|
-
-
- HY-154386
-
|
Nucleoside Antimetabolite/Analog
|
Cancer
|
5’-Azido-5’-deoxy-2’-O-(2-methoxyethyl)-5-methyluridine is a purine nucleoside analog. Purine nucleoside analogs have broad antitumor activity targeting indolent lymphoid malignancies. Anticancer mechanisms in this process rely on inhibition of DNA synthesis, induction of apoptosis, etc . 5’-Azido-5’-deoxy-2’-O-(2-methoxyethyl)-5-methyluridine is a click chemistry reagent, it contains an Azide group and can undergo copper-catalyzed azide-alkyne cycloaddition reaction (CuAAc) with molecules containing Alkyne groups. It can also undergo strain-promoted alkyne-azide cycloaddition (SPAAC) reactions with molecules containing DBCO or BCN groups.
|
-
-
- HY-154543
-
|
Nucleoside Antimetabolite/Analog
|
Cancer
|
5’-O-(4,4’-Dimethoxytrityl)-3’-O-(2-methoxyethyl) uridine is a purine nucleoside analog. Purine nucleoside analogs have broad antitumor activity targeting indolent lymphoid malignancies. Anticancer mechanisms in this process rely on inhibition of DNA synthesis, induction of apoptosis, etc .
|
-
-
- HY-WAA0006
-
|
Drug Intermediate
|
Others
|
5-(2-Methoxyethyl)-7-methyl-2,5,7-triazaspiro[3.4]octan-6-one hydrochloride is a drug intermediate for synthesis of various active compounds.
|
-
-
- HY-154552
-
|
Nucleoside Antimetabolite/Analog
|
Cancer
|
2’-O-Acetyl-5’-O-benzoyl-3’-O-(2-methoxyethyl) uridine is a uridine analog. Uridine has potential antiepileptic effects, and its analogs can be used to study anticonvulsant and anxiolytic activities, as well as to develop new antihypertensive agents .
|
-
-
- HY-154384
-
|
Nucleoside Antimetabolite/Analog
|
Cancer
|
5’-Deoxy-5’-iodo-2’-O-(2-methoxyethyl)-5-methyluridine is a purine nucleoside analog. Purine nucleoside analogs have broad antitumor activity targeting indolent lymphoid malignancies. Anticancer mechanisms in this process rely on inhibition of DNA synthesis, induction of apoptosis, etc .
|
-
-
- HY-154365
-
|
Nucleoside Antimetabolite/Analog
|
Cancer
|
5’-O-(4,4’-Dimethoxy trityl)-2’-O-(2-methoxyethyl) inosine is a purine nucleoside analog. Purine nucleoside analogs have broad antitumor activity targeting indolent lymphoid malignancies. Anticancer mechanisms in this process rely on inhibition of DNA synthesis, induction of apoptosis, etc .
|
-
-
- HY-154260
-
|
Nucleoside Antimetabolite/Analog
|
Cancer
|
N6-Benzoyl-3'-O-DMT-2'-O-(2-methoxyethyl) adenosine is a purine nucleoside analog. Purine nucleoside analogs have broad antitumor activity targeting indolent lymphoid malignancies. Anticancer mechanisms in this process rely on inhibition of DNA synthesis, induction of apoptosis, etc .
|
-
-
- HY-154441
-
|
Nucleoside Antimetabolite/Analog
|
Cancer
|
N4-Benzoyl-3'-O-DMT-2'-O-(2-methoxyethyl)-5-methylcytidine is a cytidine analog. Cytidine analogs have a mechanism of inhibiting DNA methyltransferases (such as Zebularine, HY-13420), and have potential anti-metabolic and anti-tumor activities .
|
-
-
- HY-154450
-
|
Nucleoside Antimetabolite/Analog
|
Cancer
|
N4-Benzoyl-5’-O-DMT-3’-O-(2-methoxyethyl)-5-methylcytidine is a cytidine analog. Cytidine analogs have a mechanism of inhibiting DNA methyltransferases (such as Zebularine, HY-13420), and have potential anti-metabolic and anti-tumor activities .
|
-
-
- HY-154228
-
|
Nucleoside Antimetabolite/Analog
|
Cancer
|
3’-O-(4,4’-Dimethoxy trityl)-2’-O-(2-methoxyethyl)-5-methyluridine is a purine nucleoside analog. Purine nucleoside analogs have broad antitumor activity targeting indolent lymphoid malignancies. Anticancer mechanisms in this process rely on inhibition of DNA synthesis, induction of apoptosis, etc .
|
-
-
- HY-154353
-
|
Nucleoside Antimetabolite/Analog
|
Cancer
|
5’-O-(4,4’-Dimethoxytrityl)-2’-O-(2-methoxyethyl) adenosine is an adenosine analog. Adenosine analogs mostly act as smooth muscle vasodilators and have also been shown to inhibit cancer progression. Its popular products are adenosine phosphate, Acadesine (HY-13417), Clofarabine (HY-A0005), Fludarabine phosphate (HY-B0028) and Vidarabine (HY-B0277) .
|
-
-
- HY-152525
-
|
Nucleoside Antimetabolite/Analog
|
Others
|
5-(Azidomethyl)-2’-O-(2-methoxyethyl)uridine is a thymidine analogue. Analogs of this series have insertional activity towards replicated DNA. They can be used to label cells and track DNA synthesis . 5-(Azidomethyl)-2’-O-(2-methoxyethyl)uridine is a click chemistry reagent, it contains an Azide group and can undergo copper-catalyzed azide-alkyne cycloaddition reaction (CuAAc) with molecules containing Alkyne groups. It can also undergo strain-promoted alkyne-azide cycloaddition (SPAAC) reactions with molecules containing DBCO or BCN groups.
|
-
-
- HY-152493
-
|
Nucleoside Antimetabolite/Analog
|
Others
|
3’-O-(2-Methoxyethyl)guanosine is a guanosine analogue. Some guanosine analogs have immunostimulatory activity. In some animal models, they also induce type I interferons, producing antiviral effects. Studies have shown that the functional activity of guanosine analogs is dependent on the activation of Toll-like receptor 7 (TLR7) .
|
-
-
- HY-152498
-
|
Nucleoside Antimetabolite/Analog
|
Others
|
3’-O-(2-Methoxyethyl)adenosine is an adenosine analogue. Adenosine analogs mostly act as smooth muscle vasodilators and have also been shown to inhibit cancer progression. The popular products in this series are adenosine phosphate, Acadesine (HY-13417), Clofarabine (HY-A0005), Fludarabine phosphate (HY-B0028) and Vidarabine (HY-B0277) .
|
-
-
- HY-152444
-
|
Nucleoside Antimetabolite/Analog
|
Others
|
5-Hydroxymethyl-2’-O-(2-methoxyethyl)uridine is a purine nucleoside analogue. Purine nucleoside analogs have broad antitumor activity targeting indolent lymphoid malignancies. Anticancer mechanisms in this process rely on inhibition of DNA synthesis, induction of apoptosis, etc .
|
-
-
- HY-152363
-
|
Nucleoside Antimetabolite/Analog
|
Others
|
N3-Methyl-2’-O-(2-methoxyethyl)uridine is a uridine analogue. Uridine has potential antiepileptic effects, and its analogs can be used to study anticonvulsant and anxiolytic activities, as well as to develop new antihypertensive agents .
|
-
-
- HY-154121
-
|
Nucleoside Antimetabolite/Analog
|
Cancer
|
2’-O-(2-Methoxyethyl)guanosine 5’-triphosphate (ammonium) is a purine nucleoside analog. Purine nucleoside analogs have broad antitumor activity targeting indolent lymphoid malignancies. Anticancer mechanisms in this process rely on inhibition of DNA synthesis, induction of apoptosis, etc .
|
-
- HY-154382
-
|
Nucleoside Antimetabolite/Analog
|
Cancer
|
4’,5’-Didehydro-2’-O-(2-methoxyethyl)uridine is a purine nucleoside analog. Purine nucleoside analogs have broad antitumor activity targeting indolent lymphoid malignancies. Anticancer mechanisms in this process rely on inhibition of DNA synthesis, induction of apoptosis, etc .
|
-
- HY-152503
-
|
Nucleoside Antimetabolite/Analog
|
Others
|
N6-Benzoyl-3’-O-(2-methoxyethyl)adenosine is a purine nucleoside analogue. Purine nucleoside analogs have broad antitumor activity targeting indolent lymphoid malignancies. Anticancer mechanisms in this process rely on inhibition of DNA synthesis, induction of apoptosis, etc .
|
-
- HY-154024
-
|
Nucleoside Antimetabolite/Analog
|
Cancer
|
N4-Benzoyl-2’-O-(2-methoxyethyl)cytidine is a purine nucleoside analog. Purine nucleoside analogs have broad antitumor activity targeting indolent lymphoid malignancies. Anticancer mechanisms in this process rely on inhibition of DNA synthesis, induction of apoptosis, etc .
|
-
- HY-23790
-
|
Nucleoside Antimetabolite/Analog
|
Cancer
|
N6-Benzoyl-2'-O-(2-methoxyethyl)adenosine is a purine nucleoside analog. Purine nucleoside analogs have broad antitumor activity targeting indolent lymphoid malignancies. Anticancer mechanisms in this process rely on inhibition of DNA synthesis, induction of apoptosis, etc .
|
-
- HY-154383
-
|
Nucleoside Antimetabolite/Analog
|
Cancer
|
5’-Azido-5’-deoxy-2’-O-(2-methoxyethyl)uridine is a purine nucleoside analog. Purine nucleoside analogs have broad antitumor activity targeting indolent lymphoid malignancies. Anticancer mechanisms in this process rely on inhibition of DNA synthesis, induction of apoptosis, etc . 5’-Azido-5’-deoxy-2’-O-(2-methoxyethyl)uridine is a click chemistry reagent, it contains an Azide group and can undergo copper-catalyzed azide-alkyne cycloaddition reaction (CuAAc) with molecules containing Alkyne groups. It can also undergo strain-promoted alkyne-azide cycloaddition (SPAAC) reactions with molecules containing DBCO or BCN groups.
|
-
- HY-154381
-
|
Nucleoside Antimetabolite/Analog
|
Cancer
|
5’-Deoxy-5’-iodo-2’-O-(2-methoxyethyl)uridine is a purine nucleoside analog. Purine nucleoside analogs have broad antitumor activity targeting indolent lymphoid malignancies. Anticancer mechanisms in this process rely on inhibition of DNA synthesis, induction of apoptosis, etc .
|
-
- HY-154547
-
|
Nucleoside Antimetabolite/Analog
|
Cancer
|
N2-iso-Butyroyl-3’-O-(methoxyethyl)guanosine is a guanosine analog. Some guanosine analogs have immunostimulatory activity. In some animal models, they also induce type I interferons, producing antiviral effects. Studies have shown that the functional activity of guanosine analogs is dependent on the activation of Toll-like receptor 7 (TLR7) .
|
-
- HY-W073825
-
|
Nucleoside Antimetabolite/Analog
|
Cancer
|
N2-iso-Butyryl-2'-O-(2-methoxyethyl)guanosine is a guanosine analog. Some guanosine analogs have immunostimulatory activity. In some animal models, they also induce type I interferons, producing antiviral effects. Studies have shown that the functional activity of guanosine analogs is dependent on the activation of Toll-like receptor 7 (TLR7) .
|
-
- HY-W048489
-
5'-O-(4,4'-Dimethoxytrityl)-2'-O-Methoxyethyl-thymidine
|
Nucleoside Antimetabolite/Analog
|
Others
|
DMT-2'-O-MOE-Tr (5'-O-(4,4'-Dimethoxytrityl)-2'-O-methoxyethyl-thymidine) is a nucleoside analog containing a dimethoxytrityl (DMT) group, commonly used in the synthesis of nucleic acids.
|
-
- HY-154175
-
|
Nucleoside Antimetabolite/Analog
|
Others
|
1-[6-(Diethoxyphosphinyl)-2-O-(2-methoxyethyl)-β-D-ribo-hexofuranosyl]uracil is a uridine analog. Uridine has potential antiepileptic effects, and its analogs can be used to study anticonvulsant and anxiolytic activities, as well as to develop new antihypertensive agents .
|
-
- HY-154229
-
|
Nucleoside Antimetabolite/Analog
|
Cancer
|
3’-O-DMT-N2-isobutyryl-2’-O-(2-methoxyethyl)guanosine is a purine nucleoside analog. Purine nucleoside analogs have broad antitumor activity targeting indolent lymphoid malignancies. Anticancer mechanisms in this process rely on inhibition of DNA synthesis, induction of apoptosis, etc .
|
-
- HY-13040
-
|
Nucleoside Antimetabolite/Analog
|
Cancer
|
N-Benzoyl-5'-O-dmtr-2'-O-(2-methoxyethyl)-adenosine is an adenosine analog. Adenosine analogs mostly act as smooth muscle vasodilators and have also been shown to inhibit cancer progression. Its popular products are adenosine phosphate, Acadesine (HY-13417), Clofarabine (HY-A0005), Fludarabine phosphate (HY-B0028) and Vidarabine (HY-B0277) .
|
-
- HY-154548
-
|
Nucleoside Antimetabolite/Analog
|
Others
|
N2-iso-Butyroyl-5’-O-DMT-3’-O-(methoxyethyl)guanosine is a guanosine analog. Some guanosine analogs have immunostimulatory activity. In some animal models, they also induce type I interferons, producing antiviral effects. Studies have shown that the functional activity of guanosine analogs is dependent on the activation of Toll-like receptor 7 (TLR7) .
|
-
- HY-154060
-
|
Nucleoside Antimetabolite/Analog
|
Cancer
|
N6-Benzoyl-5'-O-(4,4'-dimethoxytrityl)-3'-O-(2-methoxyethyl)adenosine is a purine nucleoside analog. Purine nucleoside analogs have broad antitumor activity targeting indolent lymphoid malignancies. Anticancer mechanisms in this process rely on inhibition of DNA synthesis, induction of apoptosis, etc .
|
-
- HY-147412
-
QR-421a
|
Nucleoside Antimetabolite/Analog
|
Others
|
Ultevursen (QR-421a) is a single-stranded RNA based oligonucleotide that is designed to skip exon 13 in the RNA with the aim to stop vision loss in people that have retinitis pigmentosa due to a mutation in exon 13 of the USH2A gene (encoding usherin). Ultevursen sequence: (P-thio)[2′-O-(2-methoxyethyl)](A-G-m 5C-m 5U-m 5U-m 5C-G-G-A-G-A-A-A-m 5U-m 5U-m 5U-A-A-A-m 5U-m 5C) .
|
-
- HY-W048494
-
N4-Benzoyl-5-methyl-5'-O-(4,4'-dimethoxytrityl)-2'-O-Methoxyethyl-cytidine
|
Nucleoside Antimetabolite/Analog
|
Others
|
N4-Bz-5-Me-DMT-2'-O-MOE-Cr (N4-Benzoyl-5-methyl-5'-O-(4,4'-dimethoxytrityl)-2'-O-methoxyethyl-cytidine) is a nucleoside analog containing a dimethoxytrityl (DMT) group, commonly used in the synthesis of nucleic acids.
|
-
- HY-113291R
-
|
Reference Standards
Endogenous Metabolite
Orthopoxvirus
|
Infection
|
4-(2-Methoxyethyl)phenol (Standard) is the analytical standard of 4-(2-Methoxyethyl)phenol. This product is intended for research and analytical applications. 4-(2-Methoxyethyl)phenol is a biochemical reagent that can be used as a biological material or organic compound for life science related research.
|
-
- HY-147217
-
ISIS 505358
|
HBV
|
Infection
|
Bepirovirsen is an antisense oligonucleotide targeting all HBV messenger RNAs. Bepirovirsen leads to reductions in HBV-derived RNAs, HBV DNA and viral proteins. Bepirovirsen can be used for the research of chronic HBV infection. Bepirovirsen binding site sequence (GCACTTCGCTTCACCTCTGC) .
|
-
- HY-145726
-
|
TNF Receptor
|
Inflammation/Immunology
|
ISIS 104838 is an antisense oligonucleotide agent that reduces the production of tumor necrosis factor (TNF-alpha), a substance that contributes to joint pain and swelling in rheumatoid arthritis.
|
-
- HY-145727
-
ISIS 304801
|
Apolipoprotein
|
Endocrinology
|
Volanesorsen (ISIS 304801) is an antisense oligonucleotide inhibitor of apolipoprotein CIII (apo-CIII) mRNA that reduces triglyceride levels and improves insulin resistance. Volanesorsen is being studied in the treatment of hypertriglyceridemia, familial chylosiderosis syndrome, and type 2 diabetes .
|
-
- HY-108764
-
ISIS 301012
|
Apolipoprotein
HCV
|
Metabolic Disease
|
Mipomersen sodium (ISIS 301012) is an antisense oligonucleotide inhibitor of apolipoprotein B (apoB). Mipomersen has anti-HCV effect and reduces the infectivity of the HCV. Mipomersen sodium can be used for the research of homozygous familial hypercholesterolemia (HoFH) .
|
-
- HY-147410
-
ION-363
|
DNA/RNA Synthesis
Others
|
Neurological Disease
|
Ulefnersen (ION363) is an Antisense Oligonucleotide (ASO) directed against the 6th intron of the fused-in sarcoma (FUS) transcript to silence FUS in a non-allele-specific manner. Ulefnersen can reduce postnatal levels of FUS protein in the brain and spinal cord in disease-relevant mouse model of ALS-FUS , delaying motor neuron degeneration. Ulefnersen can be used in the research of Amyotrophic Lateral Sclerosis (ALS) .
|
-
- HY-132581
-
BIIB078; IONIS-C9Rx
|
Ras
Others
|
Neurological Disease
|
Tadnersen (BIIB078), an antisense oligonucleotide (ASO), selectively targets C9ORF72 transcript variants 1 and 3 that carry the expansion .
|
-
- HY-132580
-
BIIB067; ISIS-SOD1Rx
|
DNA/RNA Synthesis
|
Neurological Disease
|
Tofersen (BIIB067) is an antisense oligonucleotide that mediates RNase H-dependent degradation of superoxide dismutase 1 (SOD1) mRNA to reduce the synthesis of SOD1 protein. Tofersen can be used for the research of amyotrophic lateral sclerosis (ALS) .
|
-
- HY-143230
-
OGX-011
|
Apoptosis
|
Cancer
|
Custirsen is a highly specific antisense oligonucleotide that inhibits the production of clusterin , an antiapoptotic protein that is upregulated in response to chemotherapy and that confers treatment resistance.
|
-
- HY-145722
-
OGX-427 sodium
|
HSP
|
Cancer
|
Apatorsen (sodium) is an antisense oligonucleotide designed to bind to Hsp27 mRNA, resulting in the inhibition of the production of Hsp27 protein.
|
-
- HY-145722A
-
OGX-427
|
HSP
|
Cancer
|
Apatorsen is an antisense oligonucleotide designed to bind to Hsp27 mRNA, resulting in the inhibition of the production of Hsp27 protein.
|
-
- HY-147267
-
-
- HY-148089
-
|
Transthyretin (TTR)
|
Neurological Disease
|
Eplontersen is a triantennary N-acetyl galactosamine (GalNAc3-7a)-conjugated antisense oligonucleotide targeting transthyretin (TTR) mRNA to inhibit production of both variant and wild-type TTR protein. Misfolded TTR induces amyloid fibrils formation in the heart and peripheral nerves, leads to amyloid TTR (ATTR) amyloidosis diseases .
|
-
- HY-151123
-
AKCEA-APO(a)-LRx; ISIS 681257; TQJ230
|
Apolipoprotein
|
Cardiovascular Disease
|
Pelacarsen (AKCEA-APO(a)-LRx) is a liver-specific antisense oligonucleotide against apolipoprotein(a) that reduces lipoprotein(a) up to 80% with good tolerability .
|
-
- HY-132600
-
Temavirsen
|
MicroRNA
HCV
|
Infection
|
RG-101 is a hepatocyte targeted N-acetylgalactosamine conjugated oligonucleotide that antagonises miR-122. miR-122 is an important host factor for hepatitis C virus (HCV) replication .
|
-
- HY-132579A
-
RG6042 sodium; IONIS-HTTRx sodium
|
Huntingtin
|
Neurological Disease
|
Tominersen sodium is a second-generation 2′-O-(2-methoxyethyl) antisense oligonucleotide that targets huntingtin protein (HTT) mRNA and potently suppresses HTT production. Tominersen improves survival and reduces brain atrophy in mice. Tominersen sodium can be used for the research of Huntington’s disease (HD) .
|
-
- HY-W570885
-
|
DNA/RNA Synthesis
|
Others
|
2'-O-MOE-rC is a 2'-O-MOE modified nucleoside. 2'-O-MOE-rC can be used for synthesis of DNA .
|
-
- HY-145725A
-
ISIS 598769; IONIS 598769; BIIB 065; ISIS-DMPK-2.5Rx
|
Ser/Thr Kinase
|
Others
|
Baliforsen is an antisense oligonucleotide (16 nucleotides) designed to target myotonic dystrophy protein kinase (DMPK) mRNA and research myotonic dystrophy.
|
-
- HY-150236
-
|
Huntingtin
|
Neurological Disease
|
FITC-labeled Tominersen (sodium) is the Tominersen labeled with FITC. Tominersen (RG6042) is a second-generation 2′-O-(2-methoxyethyl) antisense oligonucleotide that targets huntingtin protein (HTT) mRNA and potently suppresses HTT production. Tominersen improves survival and reduces brain atrophy in mice. Tominersen can be used for the research of Huntington’s disease (HD).
|
-
- HY-P10828
-
|
Virus Protease
|
Infection
Inflammation/Immunology
|
MAPI is a polypeptide irreversible 3C cysteine protease (SV3CP) inhibitor. MAPI inhibits SV3CP by covalently binding its C-terminal Michael-acceptor extension to the active site thiol of SV3CP Cys 139. MAPI is promising for research of noroviruses infection .
|
-
- HY-147406
-
-
- HY-159695A
-
-
- HY-159695
-
-
- HY-W336012S
-
-
- HY-112980
-
|
DNA/RNA Synthesis
|
Neurological Disease
|
Nusinersen is an antisense oligonucleotide active molecule. Nusinersen modifies the pre-messenger RNA splicing of the SMN2 gene, thereby promoting the production of full-length SMN protein. Nusinersen improves spinal muscular atrophy .
|
-
- HY-W714698
-
|
Isotope-Labeled Compounds
|
Others
|
Dimethachlor ethane sulfonic acid sodium salt-d6 is the deuterium labeled Sodium 2-((2,6-dimethylphenyl)(2-methoxyethyl)amino)-2-oxoethane-1-sulfonate (HY-W714703).
|
-
- HY-159696
-
|
GCGR
|
Metabolic Disease
|
ISIS 449884 is a 2'-O-methoxyethyl antisense oligonucleotide that targets GCGR. ISIS 449884 has an ability to reduce hepatic glucose output and lower the blood glucose level. ISIS 449884 can be used for the study of type 2 diabetes mellitus (T2DM) .
|
-
- HY-159696A
-
|
GCGR
|
Metabolic Disease
|
ISIS 449884 sodium is a 2'-O-methoxyethyl antisense oligonucleotide that targets GCGR. ISIS 449884 sodium has an ability to reduce hepatic glucose output and lower the blood glucose level. ISIS 449884 sodium can be used for the study of type 2 diabetes mellitus (T2DM) .
|
-
- HY-W714228S
-
|
Isotope-Labeled Compounds
|
Others
|
2-(2-Hydroxy-N-(2-(methoxy-d3)ethyl)acetamido)-3-methylbenzoic acid is deuterium labeled 2-(2-Hydroxy-N-(2-methoxyethyl)acetamido)-3-methylbenzoic acid .
|
-
- HY-W714702S
-
|
Isotope-Labeled Compounds
|
Others
|
2-((2,6-Dimethylphenyl)(2-(methoxy-d3)ethyl)amino)-2-oxoacetic acid is deuterium labeled 2-((2,6-Dimethylphenyl)(2-methoxyethyl)amino)-2-oxoacetic acid .
|
-
- HY-W714703S
-
|
Isotope-Labeled Compounds
|
Others
|
Sodium 2-((2,6-dimethylphenyl)(2-(methoxy-d3)ethyl)amino)-2-oxoethane-1-sulfonate is deuterium labeled Sodium 2-((2,6-dimethylphenyl)(2-methoxyethyl)amino)-2-oxoethane-1-sulfonate .
|
-
- HY-P3066
-
d(CH2)5Tyr(Et)VAVP
|
Vasopressin Receptor
|
Metabolic Disease
|
SKF 100398 (d(CH2)5Tyr(Et)VAVP), an arginine vasopressin (AVP) analogue, is a specific antagonist of the antidiuretic effect of exogenous and endogenous AVP .
|
-
Cat. No. |
Product Name |
Type |
-
- HY-150236
-
|
Dyes
|
FITC-labeled Tominersen (sodium) is the Tominersen labeled with FITC. Tominersen (RG6042) is a second-generation 2′-O-(2-methoxyethyl) antisense oligonucleotide that targets huntingtin protein (HTT) mRNA and potently suppresses HTT production. Tominersen improves survival and reduces brain atrophy in mice. Tominersen can be used for the research of Huntington’s disease (HD).
|
Cat. No. |
Product Name |
Type |
-
- HY-23789
-
2'-O-MOE-rG
|
Gene Sequencing and Synthesis
|
2′-O-(2-Methoxyethyl)guanosine (2'-O-MOE-rG) is a 2'-O-methoxyethyl-modified nucleoside analogue and an important intermediate in the synthesis of nucleic acid drugs. 2′-O-(2-Methoxyethyl)guanosine neither effectively phosphorylated by cytosolic nucleoside kinases, nor are they incorporated into cellular DNA or RNA .
|
-
- HY-42084
-
p-Hydroxyphenethyl methyl ether
|
Biochemical Assay Reagents
|
4-(2-Methoxyethyl)phenol is a biochemical reagent that can be used as a biological material or organic compound for life science related research.
|
-
- HY-42084R
-
p-Hydroxyphenethyl methyl ether (Standard)
|
Biochemical Assay Reagents
|
4-(2-Methoxyethyl)phenol (Standard) is the analytical standard of 4-(2-Methoxyethyl)phenol. This product is intended for research and analytical applications. 4-(2-Methoxyethyl)phenol is a biochemical reagent that can be used as a biological material or organic compound for life science related research.
|
Cat. No. |
Product Name |
Target |
Research Area |
-
- HY-P3066
-
d(CH2)5Tyr(Et)VAVP
|
Vasopressin Receptor
|
Metabolic Disease
|
SKF 100398 (d(CH2)5Tyr(Et)VAVP), an arginine vasopressin (AVP) analogue, is a specific antagonist of the antidiuretic effect of exogenous and endogenous AVP .
|
-
- HY-W033132
-
-
- HY-P10828
-
|
Virus Protease
|
Infection
Inflammation/Immunology
|
MAPI is a polypeptide irreversible 3C cysteine protease (SV3CP) inhibitor. MAPI inhibits SV3CP by covalently binding its C-terminal Michael-acceptor extension to the active site thiol of SV3CP Cys 139. MAPI is promising for research of noroviruses infection .
|
-
- HY-P4756
-
|
Peptides
|
Others
|
N-(2-Carbamoyl-ethyl)-Val-Leu-anilide is a polypeptide that can be found by peptide screening. Peptide screening is a research tool that pools active peptides primarily by immunoassay. Peptide screening can be used for protein interaction, functional analysis, epitope screening, especially in the field of agent research and development .
|
Cat. No. |
Product Name |
Category |
Target |
Chemical Structure |
Cat. No. |
Product Name |
Chemical Structure |
-
- HY-W013849S
-
|
Bis(2-methoxyethyl) phthalate-3,4,5,6-d4 is the deuterium labeled Bis(2-methoxyethyl) phthalate .
|
-
-
- HY-W336012S
-
|
Metoprolol EP impurity O-d7 (hydrochloride) is the deuterium labeled 3,3'-(Isopropylazanediyl)bis(1-(4-(2-methoxyethyl)phenoxy)propan-2-ol) .
|
-
-
- HY-W714698
-
|
Dimethachlor ethane sulfonic acid sodium salt-d6 is the deuterium labeled Sodium 2-((2,6-dimethylphenyl)(2-methoxyethyl)amino)-2-oxoethane-1-sulfonate (HY-W714703).
|
-
-
- HY-W714228S
-
|
2-(2-Hydroxy-N-(2-(methoxy-d3)ethyl)acetamido)-3-methylbenzoic acid is deuterium labeled 2-(2-Hydroxy-N-(2-methoxyethyl)acetamido)-3-methylbenzoic acid .
|
-
-
- HY-W714702S
-
|
2-((2,6-Dimethylphenyl)(2-(methoxy-d3)ethyl)amino)-2-oxoacetic acid is deuterium labeled 2-((2,6-Dimethylphenyl)(2-methoxyethyl)amino)-2-oxoacetic acid .
|
-
-
- HY-W714703S
-
|
Sodium 2-((2,6-dimethylphenyl)(2-(methoxy-d3)ethyl)amino)-2-oxoethane-1-sulfonate is deuterium labeled Sodium 2-((2,6-dimethylphenyl)(2-methoxyethyl)amino)-2-oxoethane-1-sulfonate .
|
-
Cat. No. |
Product Name |
|
Classification |
-
- HY-154386
-
|
|
Azide
|
5’-Azido-5’-deoxy-2’-O-(2-methoxyethyl)-5-methyluridine is a purine nucleoside analog. Purine nucleoside analogs have broad antitumor activity targeting indolent lymphoid malignancies. Anticancer mechanisms in this process rely on inhibition of DNA synthesis, induction of apoptosis, etc . 5’-Azido-5’-deoxy-2’-O-(2-methoxyethyl)-5-methyluridine is a click chemistry reagent, it contains an Azide group and can undergo copper-catalyzed azide-alkyne cycloaddition reaction (CuAAc) with molecules containing Alkyne groups. It can also undergo strain-promoted alkyne-azide cycloaddition (SPAAC) reactions with molecules containing DBCO or BCN groups.
|
-
- HY-152525
-
|
|
Azide
|
5-(Azidomethyl)-2’-O-(2-methoxyethyl)uridine is a thymidine analogue. Analogs of this series have insertional activity towards replicated DNA. They can be used to label cells and track DNA synthesis . 5-(Azidomethyl)-2’-O-(2-methoxyethyl)uridine is a click chemistry reagent, it contains an Azide group and can undergo copper-catalyzed azide-alkyne cycloaddition reaction (CuAAc) with molecules containing Alkyne groups. It can also undergo strain-promoted alkyne-azide cycloaddition (SPAAC) reactions with molecules containing DBCO or BCN groups.
|
-
- HY-154383
-
|
|
Azide
|
5’-Azido-5’-deoxy-2’-O-(2-methoxyethyl)uridine is a purine nucleoside analog. Purine nucleoside analogs have broad antitumor activity targeting indolent lymphoid malignancies. Anticancer mechanisms in this process rely on inhibition of DNA synthesis, induction of apoptosis, etc . 5’-Azido-5’-deoxy-2’-O-(2-methoxyethyl)uridine is a click chemistry reagent, it contains an Azide group and can undergo copper-catalyzed azide-alkyne cycloaddition reaction (CuAAc) with molecules containing Alkyne groups. It can also undergo strain-promoted alkyne-azide cycloaddition (SPAAC) reactions with molecules containing DBCO or BCN groups.
|
Cat. No. |
Product Name |
|
Classification |
-
- HY-W048495
-
|
|
Nucleosides and their Analogs
U
|
2'-O-(2-Methoxyethyl)-uridine is a synthetic oligonucleotide conversed from uridine. 2'-O-(2-Methoxyethyl)-uridine has the potential for chemotherapeutic agents development .
|
-
- HY-132579
-
RG6042; IONIS-HTTRx
|
|
Antisense Oligonucleotides
|
Tominersen (RG6042) is a second-generation 2′-O-(2-methoxyethyl) antisense oligonucleotide that targets huntingtin protein (HTT) mRNA and potently suppresses HTT production. Tominersen improves survival and reduces brain atrophy in mice. Tominersen can be used for the research of Huntington’s disease (HD) .
|
-
- HY-W048496
-
|
|
Nucleosides and their Analogs
C
|
2'-O-(2-Methoxyethyl)-cytidine is a synthetic oligonucleotide derived from uridine. 2'-O-(2-Methoxyethyl)-cytidine has good hybridization properties and high stability, and can be used in the research of oligonucleotide chemotherapeutic agents .
|
-
- HY-W048491
-
-
- HY-154285
-
|
|
Nucleosides and their Analogs
U
|
3’-O-(2-Methoxyethyl) uridine is a uridine analog. Uridine has potential antiepileptic effects, and its analogs can be used to study anticonvulsant and anxiolytic activities, as well as to develop new antihypertensive agents .
|
-
- HY-152516
-
|
|
Nucleosides and their Analogs
I
|
2’-O-(2-Methoxyethyl) inosine is a purine nucleoside analog. Purine nucleoside analogs have broad antitumor activity targeting indolent lymphoid malignancies. Anticancer mechanisms in this process rely on inhibition of DNA synthesis, induction of apoptosis, etc .
|
-
- HY-152577
-
|
|
Nucleosides and their Analogs
I
|
3’-O-(2-Methoxyethyl) inosine is a purine nucleoside analog. Purine nucleoside analogs have broad antitumor activity targeting indolent lymphoid malignancies. Anticancer mechanisms in this process rely on inhibition of DNA synthesis, induction of apoptosis, etc .
|
-
- HY-154434
-
|
|
Nucleosides and their Analogs
U
|
3’-O-(2-Methoxyethyl)-5-methyluridine is a thymidine analog. Analogs of this series have insertional activity towards replicated DNA. They can be used to label cells and track DNA synthesis .
|
-
- HY-152480
-
|
|
Nucleosides and their Analogs
C
|
3’-O-(2-Methoxyethyl)-5-methylcytidine is a cytidine analog. Cytidine analogs have a mechanism of inhibiting DNA methyltransferases (such as Zebularine, HY-13420), and have potential anti-metabolic and anti-tumor activities .
|
-
- HY-152482
-
|
|
Nucleosides and their Analogs
U
|
3’-O-(2-Methoxyethyl)-2-thiouridine is a purine nucleoside analog. Purine nucleoside analogs have broad antitumor activity targeting indolent lymphoid malignancies. Anticancer mechanisms in this process rely on inhibition of DNA synthesis, induction of apoptosis, etc .
|
-
- HY-152549
-
|
|
Nucleosides and their Analogs
A
|
2’-O-(2-Methoxyethyl)-2-aminoadenosine is a purine nucleoside analogue. Purine nucleoside analogs have broad antitumor activity targeting indolent lymphoid malignancies. Anticancer mechanisms in this process rely on inhibition of DNA synthesis, induction of apoptosis, etc .
|
-
- HY-152646
-
|
|
Nucleosides and their Analogs
A
|
3’-O-(2-Methoxyethyl)-2-aminoadenosine is an adenosine analog. Adenosine analogs mostly act as smooth muscle vasodilators and have also been shown to inhibit cancer progression. Its popular products are adenosine phosphate, Acadesine (HY-13417), Clofarabine (HY-A0005), Fludarabine phosphate (HY-B0028) and Vidarabine (HY-B0277) .
|
-
- HY-152573
-
|
|
Nucleosides and their Analogs
A
|
N1-Methyl-3’-O-(2-methoxyethyl) adenosine is a purine nucleoside analog. Purine nucleoside analogs have broad antitumor activity targeting indolent lymphoid malignancies. Anticancer mechanisms in this process rely on inhibition of DNA synthesis, induction of apoptosis, etc .
|
-
- HY-152571
-
|
|
Nucleosides and their Analogs
I
|
N1-Methyl-2’-O-(2-methoxyethyl) inosine is a purine nucleoside analog. Purine nucleoside analogs have broad antitumor activity targeting indolent lymphoid malignancies. Anticancer mechanisms in this process rely on inhibition of DNA synthesis, induction of apoptosis, etc .
|
-
- HY-152575
-
|
|
Nucleosides and their Analogs
A
|
N6-Methyl-3’-O-(2-methoxyethyl) adenosine is a purine nucleoside analog. Purine nucleoside analogs have broad antitumor activity targeting indolent lymphoid malignancies. Anticancer mechanisms in this process rely on inhibition of DNA synthesis, induction of apoptosis, etc .
|
-
- HY-152569
-
|
|
Nucleosides and their Analogs
A
|
N1-Methyl-2’-O-(2-methoxyethyl) adenosine is a purine nucleoside analog. Purine nucleoside analogs have broad antitumor activity targeting indolent lymphoid malignancies. Anticancer mechanisms in this process rely on inhibition of DNA synthesis, induction of apoptosis, etc .
|
-
- HY-152570
-
|
|
Nucleosides and their Analogs
A
|
N6-Methyl-2’-O-(2-methoxyethyl) adenosine is a purine nucleoside analog. Purine nucleoside analogs have broad antitumor activity targeting indolent lymphoid malignancies. Anticancer mechanisms in this process rely on inhibition of DNA synthesis, induction of apoptosis, etc .
|
-
- HY-152567
-
|
|
Nucleosides and their Analogs
G
|
N1-Methyl-2’-O-(2-methoxyethyl) guanosine is a purine nucleoside analog. Purine nucleoside analogs have broad antitumor activity targeting indolent lymphoid malignancies. Anticancer mechanisms in this process rely on inhibition of DNA synthesis, induction of apoptosis, etc .
|
-
- HY-152587
-
|
|
Nucleosides and their Analogs
I
|
N1-Methyl-3’-O-(2-methoxyethyl) inosine is a purine nucleoside analog. Purine nucleoside analogs have broad antitumor activity targeting indolent lymphoid malignancies. Anticancer mechanisms in this process rely on inhibition of DNA synthesis, induction of apoptosis, etc .
|
-
- HY-152568
-
|
|
Nucleosides and their Analogs
G
|
N7-Methyl-2’-O-(2-methoxyethyl) guanosine is a purine nucleoside analog. Purine nucleoside analogs have broad antitumor activity targeting indolent lymphoid malignancies. Anticancer mechanisms in this process rely on inhibition of DNA synthesis, induction of apoptosis, etc .
|
-
- HY-154173
-
|
|
Nucleosides and their Analogs
U
|
3’-O-(t-Butyldimethylsilyl)-2’-O-(2-methoxyethyl) uridine is a uridine analog. Uridine has potential antiepileptic effects, and its analogs can be used to study anticonvulsant and anxiolytic activities, as well as to develop new antihypertensive agents .
|
-
- HY-154240
-
|
|
Nucleosides and their Analogs
A
|
2-Amino-2’,3’-bis-O-(2-methoxyethyl) adenosine is a purine nucleoside analog. Purine nucleoside analogs have broad antitumor activity targeting indolent lymphoid malignancies. Anticancer mechanisms in this process rely on inhibition of DNA synthesis, induction of apoptosis, etc .
|
-
- HY-154385
-
|
|
Nucleosides and their Analogs
U
|
4’,5’-Didehydro-2’-O-(2-methoxyethyl)-5-methyluridine is a purine nucleoside analog. Purine nucleoside analogs have broad antitumor activity targeting indolent lymphoid malignancies. Anticancer mechanisms in this process rely on inhibition of DNA synthesis, induction of apoptosis, etc .
|
-
- HY-154290
-
|
|
Nucleosides and their Analogs
U
|
N3,5-Dimethyl-2’-O-(2-methoxyethyl) uridine is a purine nucleoside analog. Purine nucleoside analogs have broad antitumor activity targeting indolent lymphoid malignancies. Anticancer mechanisms in this process rely on inhibition of DNA synthesis, induction of apoptosis, etc .
|
-
- HY-132608
-
ISIS-420915 sodium
|
|
Antisense Oligonucleotides
|
Inotersen (ISIS-420915) sodium is a 2′-O-methoxyethyl-modified antisense oligonucleotide. Inotersen sodium inhibits the production of transthyretin (TTR) protein by targeting the TTR RNA transcript and reduces the levels of the TTR transcript. Inotersen sodium can be used for the research of hereditary TTR amyloidosis polyneuropathy .
|
-
- HY-154449
-
|
|
Nucleosides and their Analogs
C
|
N4-Benzoyl-3’-O-(2-methoxyethyl)-5-methylcytidine is a purine nucleoside analog. Purine nucleoside analogs have broad antitumor activity targeting indolent lymphoid malignancies. Anticancer mechanisms in this process rely on inhibition of DNA synthesis, induction of apoptosis, etc .
|
-
- HY-152382
-
|
|
Nucleosides and their Analogs
C
|
3’-O-(2-Methoxyethyl)cytidine is a cytidine analog. Cytidine analogs have a mechanism of inhibiting DNA methyltransferases (such as Zebularine, HY-13420), and have potential anti-metabolic and anti-tumor activities .
|
-
- HY-154386
-
|
|
Nucleosides and their Analogs
U
|
5’-Azido-5’-deoxy-2’-O-(2-methoxyethyl)-5-methyluridine is a purine nucleoside analog. Purine nucleoside analogs have broad antitumor activity targeting indolent lymphoid malignancies. Anticancer mechanisms in this process rely on inhibition of DNA synthesis, induction of apoptosis, etc . 5’-Azido-5’-deoxy-2’-O-(2-methoxyethyl)-5-methyluridine is a click chemistry reagent, it contains an Azide group and can undergo copper-catalyzed azide-alkyne cycloaddition reaction (CuAAc) with molecules containing Alkyne groups. It can also undergo strain-promoted alkyne-azide cycloaddition (SPAAC) reactions with molecules containing DBCO or BCN groups.
|
-
- HY-154543
-
|
|
Nucleosides and their Analogs
U
|
5’-O-(4,4’-Dimethoxytrityl)-3’-O-(2-methoxyethyl) uridine is a purine nucleoside analog. Purine nucleoside analogs have broad antitumor activity targeting indolent lymphoid malignancies. Anticancer mechanisms in this process rely on inhibition of DNA synthesis, induction of apoptosis, etc .
|
-
- HY-154552
-
|
|
Nucleosides and their Analogs
U
|
2’-O-Acetyl-5’-O-benzoyl-3’-O-(2-methoxyethyl) uridine is a uridine analog. Uridine has potential antiepileptic effects, and its analogs can be used to study anticonvulsant and anxiolytic activities, as well as to develop new antihypertensive agents .
|
-
- HY-154384
-
|
|
Nucleosides and their Analogs
U
|
5’-Deoxy-5’-iodo-2’-O-(2-methoxyethyl)-5-methyluridine is a purine nucleoside analog. Purine nucleoside analogs have broad antitumor activity targeting indolent lymphoid malignancies. Anticancer mechanisms in this process rely on inhibition of DNA synthesis, induction of apoptosis, etc .
|
-
- HY-154365
-
|
|
Nucleosides and their Analogs
I
|
5’-O-(4,4’-Dimethoxy trityl)-2’-O-(2-methoxyethyl) inosine is a purine nucleoside analog. Purine nucleoside analogs have broad antitumor activity targeting indolent lymphoid malignancies. Anticancer mechanisms in this process rely on inhibition of DNA synthesis, induction of apoptosis, etc .
|
-
- HY-154260
-
|
|
Nucleosides and their Analogs
A
|
N6-Benzoyl-3'-O-DMT-2'-O-(2-methoxyethyl) adenosine is a purine nucleoside analog. Purine nucleoside analogs have broad antitumor activity targeting indolent lymphoid malignancies. Anticancer mechanisms in this process rely on inhibition of DNA synthesis, induction of apoptosis, etc .
|
-
- HY-154441
-
|
|
Nucleosides and their Analogs
C
|
N4-Benzoyl-3'-O-DMT-2'-O-(2-methoxyethyl)-5-methylcytidine is a cytidine analog. Cytidine analogs have a mechanism of inhibiting DNA methyltransferases (such as Zebularine, HY-13420), and have potential anti-metabolic and anti-tumor activities .
|
-
- HY-154450
-
|
|
Nucleosides and their Analogs
C
|
N4-Benzoyl-5’-O-DMT-3’-O-(2-methoxyethyl)-5-methylcytidine is a cytidine analog. Cytidine analogs have a mechanism of inhibiting DNA methyltransferases (such as Zebularine, HY-13420), and have potential anti-metabolic and anti-tumor activities .
|
-
- HY-154228
-
|
|
Nucleosides and their Analogs
U
|
3’-O-(4,4’-Dimethoxy trityl)-2’-O-(2-methoxyethyl)-5-methyluridine is a purine nucleoside analog. Purine nucleoside analogs have broad antitumor activity targeting indolent lymphoid malignancies. Anticancer mechanisms in this process rely on inhibition of DNA synthesis, induction of apoptosis, etc .
|
-
- HY-154353
-
|
|
Nucleosides and their Analogs
A
|
5’-O-(4,4’-Dimethoxytrityl)-2’-O-(2-methoxyethyl) adenosine is an adenosine analog. Adenosine analogs mostly act as smooth muscle vasodilators and have also been shown to inhibit cancer progression. Its popular products are adenosine phosphate, Acadesine (HY-13417), Clofarabine (HY-A0005), Fludarabine phosphate (HY-B0028) and Vidarabine (HY-B0277) .
|
-
- HY-152525
-
|
|
Nucleosides and their Analogs
U
|
5-(Azidomethyl)-2’-O-(2-methoxyethyl)uridine is a thymidine analogue. Analogs of this series have insertional activity towards replicated DNA. They can be used to label cells and track DNA synthesis . 5-(Azidomethyl)-2’-O-(2-methoxyethyl)uridine is a click chemistry reagent, it contains an Azide group and can undergo copper-catalyzed azide-alkyne cycloaddition reaction (CuAAc) with molecules containing Alkyne groups. It can also undergo strain-promoted alkyne-azide cycloaddition (SPAAC) reactions with molecules containing DBCO or BCN groups.
|
-
- HY-152493
-
|
|
Nucleosides and their Analogs
G
|
3’-O-(2-Methoxyethyl)guanosine is a guanosine analogue. Some guanosine analogs have immunostimulatory activity. In some animal models, they also induce type I interferons, producing antiviral effects. Studies have shown that the functional activity of guanosine analogs is dependent on the activation of Toll-like receptor 7 (TLR7) .
|
-
- HY-152498
-
|
|
Nucleosides and their Analogs
A
|
3’-O-(2-Methoxyethyl)adenosine is an adenosine analogue. Adenosine analogs mostly act as smooth muscle vasodilators and have also been shown to inhibit cancer progression. The popular products in this series are adenosine phosphate, Acadesine (HY-13417), Clofarabine (HY-A0005), Fludarabine phosphate (HY-B0028) and Vidarabine (HY-B0277) .
|
-
- HY-152444
-
|
|
Nucleosides and their Analogs
U
|
5-Hydroxymethyl-2’-O-(2-methoxyethyl)uridine is a purine nucleoside analogue. Purine nucleoside analogs have broad antitumor activity targeting indolent lymphoid malignancies. Anticancer mechanisms in this process rely on inhibition of DNA synthesis, induction of apoptosis, etc .
|
-
- HY-152363
-
|
|
Nucleosides and their Analogs
U
|
N3-Methyl-2’-O-(2-methoxyethyl)uridine is a uridine analogue. Uridine has potential antiepileptic effects, and its analogs can be used to study anticonvulsant and anxiolytic activities, as well as to develop new antihypertensive agents .
|
-
- HY-154121
-
|
|
Nucleosides and their Analogs
G
|
2’-O-(2-Methoxyethyl)guanosine 5’-triphosphate (ammonium) is a purine nucleoside analog. Purine nucleoside analogs have broad antitumor activity targeting indolent lymphoid malignancies. Anticancer mechanisms in this process rely on inhibition of DNA synthesis, induction of apoptosis, etc .
|
-
- HY-154382
-
|
|
Nucleosides and their Analogs
U
|
4’,5’-Didehydro-2’-O-(2-methoxyethyl)uridine is a purine nucleoside analog. Purine nucleoside analogs have broad antitumor activity targeting indolent lymphoid malignancies. Anticancer mechanisms in this process rely on inhibition of DNA synthesis, induction of apoptosis, etc .
|
-
- HY-152503
-
|
|
Nucleosides and their Analogs
A
|
N6-Benzoyl-3’-O-(2-methoxyethyl)adenosine is a purine nucleoside analogue. Purine nucleoside analogs have broad antitumor activity targeting indolent lymphoid malignancies. Anticancer mechanisms in this process rely on inhibition of DNA synthesis, induction of apoptosis, etc .
|
-
- HY-154024
-
|
|
Nucleosides and their Analogs
C
|
N4-Benzoyl-2’-O-(2-methoxyethyl)cytidine is a purine nucleoside analog. Purine nucleoside analogs have broad antitumor activity targeting indolent lymphoid malignancies. Anticancer mechanisms in this process rely on inhibition of DNA synthesis, induction of apoptosis, etc .
|
-
- HY-23790
-
|
|
Nucleosides and their Analogs
A
|
N6-Benzoyl-2'-O-(2-methoxyethyl)adenosine is a purine nucleoside analog. Purine nucleoside analogs have broad antitumor activity targeting indolent lymphoid malignancies. Anticancer mechanisms in this process rely on inhibition of DNA synthesis, induction of apoptosis, etc .
|
-
- HY-154383
-
|
|
Nucleosides and their Analogs
U
|
5’-Azido-5’-deoxy-2’-O-(2-methoxyethyl)uridine is a purine nucleoside analog. Purine nucleoside analogs have broad antitumor activity targeting indolent lymphoid malignancies. Anticancer mechanisms in this process rely on inhibition of DNA synthesis, induction of apoptosis, etc . 5’-Azido-5’-deoxy-2’-O-(2-methoxyethyl)uridine is a click chemistry reagent, it contains an Azide group and can undergo copper-catalyzed azide-alkyne cycloaddition reaction (CuAAc) with molecules containing Alkyne groups. It can also undergo strain-promoted alkyne-azide cycloaddition (SPAAC) reactions with molecules containing DBCO or BCN groups.
|
-
- HY-154381
-
|
|
Nucleosides and their Analogs
U
|
5’-Deoxy-5’-iodo-2’-O-(2-methoxyethyl)uridine is a purine nucleoside analog. Purine nucleoside analogs have broad antitumor activity targeting indolent lymphoid malignancies. Anticancer mechanisms in this process rely on inhibition of DNA synthesis, induction of apoptosis, etc .
|
-
- HY-154547
-
|
|
Nucleosides and their Analogs
G
|
N2-iso-Butyroyl-3’-O-(methoxyethyl)guanosine is a guanosine analog. Some guanosine analogs have immunostimulatory activity. In some animal models, they also induce type I interferons, producing antiviral effects. Studies have shown that the functional activity of guanosine analogs is dependent on the activation of Toll-like receptor 7 (TLR7) .
|
- HY-W073825
-
|
|
Nucleosides and their Analogs
G
|
N2-iso-Butyryl-2'-O-(2-methoxyethyl)guanosine is a guanosine analog. Some guanosine analogs have immunostimulatory activity. In some animal models, they also induce type I interferons, producing antiviral effects. Studies have shown that the functional activity of guanosine analogs is dependent on the activation of Toll-like receptor 7 (TLR7) .
|
- HY-154175
-
|
|
Nucleosides and their Analogs
U
|
1-[6-(Diethoxyphosphinyl)-2-O-(2-methoxyethyl)-β-D-ribo-hexofuranosyl]uracil is a uridine analog. Uridine has potential antiepileptic effects, and its analogs can be used to study anticonvulsant and anxiolytic activities, as well as to develop new antihypertensive agents .
|
- HY-154229
-
|
|
Nucleosides and their Analogs
G
|
3’-O-DMT-N2-isobutyryl-2’-O-(2-methoxyethyl)guanosine is a purine nucleoside analog. Purine nucleoside analogs have broad antitumor activity targeting indolent lymphoid malignancies. Anticancer mechanisms in this process rely on inhibition of DNA synthesis, induction of apoptosis, etc .
|
- HY-13040
-
|
|
Nucleosides and their Analogs
A
|
N-Benzoyl-5'-O-dmtr-2'-O-(2-methoxyethyl)-adenosine is an adenosine analog. Adenosine analogs mostly act as smooth muscle vasodilators and have also been shown to inhibit cancer progression. Its popular products are adenosine phosphate, Acadesine (HY-13417), Clofarabine (HY-A0005), Fludarabine phosphate (HY-B0028) and Vidarabine (HY-B0277) .
|
- HY-154548
-
|
|
Nucleosides and their Analogs
G
|
N2-iso-Butyroyl-5’-O-DMT-3’-O-(methoxyethyl)guanosine is a guanosine analog. Some guanosine analogs have immunostimulatory activity. In some animal models, they also induce type I interferons, producing antiviral effects. Studies have shown that the functional activity of guanosine analogs is dependent on the activation of Toll-like receptor 7 (TLR7) .
|
- HY-154060
-
|
|
Nucleosides and their Analogs
A
|
N6-Benzoyl-5'-O-(4,4'-dimethoxytrityl)-3'-O-(2-methoxyethyl)adenosine is a purine nucleoside analog. Purine nucleoside analogs have broad antitumor activity targeting indolent lymphoid malignancies. Anticancer mechanisms in this process rely on inhibition of DNA synthesis, induction of apoptosis, etc .
|
- HY-147412
-
QR-421a
|
|
Antisense Oligonucleotides
|
Ultevursen (QR-421a) is a single-stranded RNA based oligonucleotide that is designed to skip exon 13 in the RNA with the aim to stop vision loss in people that have retinitis pigmentosa due to a mutation in exon 13 of the USH2A gene (encoding usherin). Ultevursen sequence: (P-thio)[2′-O-(2-methoxyethyl)](A-G-m 5C-m 5U-m 5U-m 5C-G-G-A-G-A-A-A-m 5U-m 5U-m 5U-A-A-A-m 5U-m 5C) .
|
- HY-147217
-
ISIS 505358
|
|
Antisense Oligonucleotides
|
Bepirovirsen is an antisense oligonucleotide targeting all HBV messenger RNAs. Bepirovirsen leads to reductions in HBV-derived RNAs, HBV DNA and viral proteins. Bepirovirsen can be used for the research of chronic HBV infection. Bepirovirsen binding site sequence (GCACTTCGCTTCACCTCTGC) .
|
- HY-145726
-
|
|
Antisense Oligonucleotides
|
ISIS 104838 is an antisense oligonucleotide agent that reduces the production of tumor necrosis factor (TNF-alpha), a substance that contributes to joint pain and swelling in rheumatoid arthritis.
|
- HY-145727
-
ISIS 304801
|
|
Antisense Oligonucleotides
|
Volanesorsen (ISIS 304801) is an antisense oligonucleotide inhibitor of apolipoprotein CIII (apo-CIII) mRNA that reduces triglyceride levels and improves insulin resistance. Volanesorsen is being studied in the treatment of hypertriglyceridemia, familial chylosiderosis syndrome, and type 2 diabetes .
|
- HY-108764
-
ISIS 301012
|
|
Antisense Oligonucleotides
|
Mipomersen sodium (ISIS 301012) is an antisense oligonucleotide inhibitor of apolipoprotein B (apoB). Mipomersen has anti-HCV effect and reduces the infectivity of the HCV. Mipomersen sodium can be used for the research of homozygous familial hypercholesterolemia (HoFH) .
|
- HY-147410
-
ION-363
|
|
Antisense Oligonucleotides
|
Ulefnersen (ION363) is an Antisense Oligonucleotide (ASO) directed against the 6th intron of the fused-in sarcoma (FUS) transcript to silence FUS in a non-allele-specific manner. Ulefnersen can reduce postnatal levels of FUS protein in the brain and spinal cord in disease-relevant mouse model of ALS-FUS , delaying motor neuron degeneration. Ulefnersen can be used in the research of Amyotrophic Lateral Sclerosis (ALS) .
|
- HY-132581
-
BIIB078; IONIS-C9Rx
|
|
Antisense Oligonucleotides
|
Tadnersen (BIIB078), an antisense oligonucleotide (ASO), selectively targets C9ORF72 transcript variants 1 and 3 that carry the expansion .
|
- HY-132580
-
BIIB067; ISIS-SOD1Rx
|
|
Antisense Oligonucleotides
|
Tofersen (BIIB067) is an antisense oligonucleotide that mediates RNase H-dependent degradation of superoxide dismutase 1 (SOD1) mRNA to reduce the synthesis of SOD1 protein. Tofersen can be used for the research of amyotrophic lateral sclerosis (ALS) .
|
- HY-143230
-
OGX-011
|
|
Antisense Oligonucleotides
|
Custirsen is a highly specific antisense oligonucleotide that inhibits the production of clusterin , an antiapoptotic protein that is upregulated in response to chemotherapy and that confers treatment resistance.
|
- HY-145722
-
OGX-427 sodium
|
|
Antisense Oligonucleotides
|
Apatorsen (sodium) is an antisense oligonucleotide designed to bind to Hsp27 mRNA, resulting in the inhibition of the production of Hsp27 protein.
|
- HY-145722A
-
OGX-427
|
|
Antisense Oligonucleotides
|
Apatorsen is an antisense oligonucleotide designed to bind to Hsp27 mRNA, resulting in the inhibition of the production of Hsp27 protein.
|
- HY-147267
-
ISIS-757456
|
|
Antisense Oligonucleotides
|
Evazarsen is an angiotensinogen synthesis inhibitor and possesses antihypertensive properties .
|
- HY-148089
-
|
|
Antisense Oligonucleotides
|
Eplontersen is a triantennary N-acetyl galactosamine (GalNAc3-7a)-conjugated antisense oligonucleotide targeting transthyretin (TTR) mRNA to inhibit production of both variant and wild-type TTR protein. Misfolded TTR induces amyloid fibrils formation in the heart and peripheral nerves, leads to amyloid TTR (ATTR) amyloidosis diseases .
|
- HY-151123
-
AKCEA-APO(a)-LRx; ISIS 681257; TQJ230
|
|
Antisense Oligonucleotides
|
Pelacarsen (AKCEA-APO(a)-LRx) is a liver-specific antisense oligonucleotide against apolipoprotein(a) that reduces lipoprotein(a) up to 80% with good tolerability .
|
- HY-132600
-
Temavirsen
|
|
Antisense Oligonucleotides
|
RG-101 is a hepatocyte targeted N-acetylgalactosamine conjugated oligonucleotide that antagonises miR-122. miR-122 is an important host factor for hepatitis C virus (HCV) replication .
|
- HY-132579A
-
RG6042 sodium; IONIS-HTTRx sodium
|
|
Antisense Oligonucleotides
|
Tominersen sodium is a second-generation 2′-O-(2-methoxyethyl) antisense oligonucleotide that targets huntingtin protein (HTT) mRNA and potently suppresses HTT production. Tominersen improves survival and reduces brain atrophy in mice. Tominersen sodium can be used for the research of Huntington’s disease (HD) .
|
- HY-W570885
-
- HY-145725A
-
ISIS 598769; IONIS 598769; BIIB 065; ISIS-DMPK-2.5Rx
|
|
Antisense Oligonucleotides
|
Baliforsen is an antisense oligonucleotide (16 nucleotides) designed to target myotonic dystrophy protein kinase (DMPK) mRNA and research myotonic dystrophy.
|
- HY-145725
-
IONIS 598769 sodium; ISIS 598769 sodium
|
|
Antisense Oligonucleotides
|
Baliforsen (sodium) is an antisense oligonucleotide (16 nucleotides) designed to target myotonic dystrophy protein kinase (DMPK) mRNA and research myotonic dystrophy.
|
- HY-150236
-
|
|
Antisense Oligonucleotides
|
FITC-labeled Tominersen (sodium) is the Tominersen labeled with FITC. Tominersen (RG6042) is a second-generation 2′-O-(2-methoxyethyl) antisense oligonucleotide that targets huntingtin protein (HTT) mRNA and potently suppresses HTT production. Tominersen improves survival and reduces brain atrophy in mice. Tominersen can be used for the research of Huntington’s disease (HD).
|
- HY-147406
-
- HY-159695A
-
ISIS 426115 sodium
|
|
Antisense Oligonucleotides
|
IONIS-GCCRRx (ISIS 426115) sodium, a glucocorticoid receptor antagonist, is a 2'-O-methoxyethyl (2'-MOE) antisense oligonucleotide (ASO) .
|
- HY-159695
-
ISIS 426115
|
|
Antisense Oligonucleotides
|
IONIS-GCCRRx (ISIS 426115), a glucocorticoid receptor antagonist, is a 2'-O-methoxyethyl (2'-MOE) antisense oligonucleotide (ASO) .
|
- HY-112980
-
|
|
Antisense Oligonucleotides
|
Nusinersen is an antisense oligonucleotide active molecule. Nusinersen modifies the pre-messenger RNA splicing of the SMN2 gene, thereby promoting the production of full-length SMN protein. Nusinersen improves spinal muscular atrophy .
|
- HY-159696
-
|
|
Antisense Oligonucleotides
|
ISIS 449884 is a 2'-O-methoxyethyl antisense oligonucleotide that targets GCGR. ISIS 449884 has an ability to reduce hepatic glucose output and lower the blood glucose level. ISIS 449884 can be used for the study of type 2 diabetes mellitus (T2DM) .
|
- HY-159696A
-
|
|
Antisense Oligonucleotides
|
ISIS 449884 sodium is a 2'-O-methoxyethyl antisense oligonucleotide that targets GCGR. ISIS 449884 sodium has an ability to reduce hepatic glucose output and lower the blood glucose level. ISIS 449884 sodium can be used for the study of type 2 diabetes mellitus (T2DM) .
|
Your information is safe with us. * Required Fields.
Inquiry Information
- Product Name:
- Cat. No.:
- Quantity:
- MCE Japan Authorized Agent: