SiRNA Negative Control

Cat. No.: HY-150150 Purity: 96.40%: Data Sheet
SDS

COA
Handling Instructions
FAQs
Technical Support

SiRNA Negative Control is a siRNA of 21 nucleotides, and can be used as a negative control. SiRNA Negative Control has no homology to most known gene sequence. SiRNA Negative Control is available with fluorescent labels, allowing rapid assessment of transfection efficiency. SiRNA Negative Control can be used in human, mouse and rat cells in vitro. SiRNA Negative Control can be used as experimental control benchmark, verification of experimental reliability and standardization reference. SiRNA Negative Control is a common negative control used in most research articles.

For research use only. We do not sell to patients.

RNA, (UUCUCCGAACGUGUCACGUUU), complex with RNA, (ACGUGACACGUUCGGAGAAUU) (1:1)

SiRNA Negative Control Chemical Structure

Size	Stock	Quantity
1 mg	In-stock	Estimated Time of Arrival: December 31
5 mg	In-stock	Estimated Time of Arrival: December 31
10 mg	In-stock	Estimated Time of Arrival: December 31
50 mg	Get quote
100 mg	Get quote

or Bulk Inquiry

* Please select Quantity before adding items.

This product is a controlled substance and not for sale in your territory.

Customer Review

Based on 4 publication(s) in Google Scholar

4 Publications Citing Use of MCE SiRNA Negative Control

Featured Recommendations

•Related Small Molecules:

•Related Proteins:

Biological Activity
Purity & Documentation
Customer Review

Description	SiRNA Negative Control is a siRNA of 21 nucleotides, and can be used as a negative control. SiRNA Negative Control has no homology to most known gene sequence. SiRNA Negative Control is available with fluorescent labels, allowing rapid assessment of transfection efficiency. SiRNA Negative Control can be used in human, mouse and rat cells in vitro. SiRNA Negative Control can be used as experimental control benchmark, verification of experimental reliability and standardization reference. SiRNA Negative Control is a common negative control used in most research articles.
Molecular Weight	13323 ( AS: 6586.9; SS: 6736.1 )
Appearance	Solid
Color	White to off-white
SMILES	[RNA, (UUCUCCGAACGUGUCACGUUU), complex with RNA, (ACGUGACACGUUCGGAGAAUU) (1:1)]
Shipping	Room temperature in continental US; may vary elsewhere.
Storage	-20°C, sealed storage, away from moisture *In solvent : -80°C, 6 months; -20°C, 1 month (sealed storage, away from moisture)
Solvent & Solubility	In Vitro: H₂O : 100 mg/mL (Need ultrasonic) Molarity Calculator Dilution Calculator Mass (g) = Concentration (mol/L) × Volume (L) × Molecular Weight (g/mol) Mass = Concentration × Volume × Molecular Weight * Concentration _(start) × Volume _(start) = Concentration _(final) × Volume _(final) This equation is commonly abbreviated as: C₁V₁ = C₂V₂ Concentration _(start) C1 × Volume _(start) V1 = Concentration _(final) C2 × Volume _(final) V2 In Vivo Dissolution Calculator Please enter the basic information of animal experiments: Dosage mg/kg Animal weight (per animal) g Dosing volume (per animal) μL Number of animals Recommended: Prepare an additional quantity of animals to account for potential losses during experiments. Calculation results: Working solution concentration: mg/mL This product has good water solubility, please refer to the measured solubility data in water/PBS/Saline for details. The concentration of the stock solution you require exceeds the measured solubility. The following solution is for reference only.If necessary, please contact MedChemExpress (MCE). Tel: 609-228-6898 E-mail: sales@medchemexpress.com Technical Support: tech@medchemexpress.com
Purity & Documentation	Purity: 96.40% Select Batch: Data Sheet (238 KB) SDS (251 KB) COA (239 KB) RP-HPLC (209 KB) Handling Instructions (2659 KB)