1. Epigenetics
  2. Small Interfering RNA (siRNA)
  3. SiRNA Negative Control

SiRNA Negative Control is a siRNA of 21 nucleotides, and can be used as a negative control. SiRNA Negative Control has no homology to most known gene sequence. SiRNA Negative Control can be used in human, mouse and rat cells in vitro. SiRNA Negative Control can be used as experimental control benchmark, verification of experimental reliability and standardization reference. SiRNA Negative Control is a common negative control used in most research articles.

For research use only. We do not sell to patients.

RNA, (UUCUCCGAACGUGUCACGUUU), complex with RNA, (ACGUGACACGUUCGGAGAAUU) (1:1)

SiRNA Negative Control Chemical Structure

Size Price Stock Quantity
1 mg In-stock
5 mg In-stock
10 mg In-stock
50 mg   Get quote  
100 mg   Get quote  

* Please select Quantity before adding items.

This product is a controlled substance and not for sale in your territory.

Customer Review

Based on 10 publication(s) in Google Scholar

Other Forms of SiRNA Negative Control:

Top Publications Citing Use of Products
  • Biological Activity

  • Purity & Documentation

  • Customer Review

Description

SiRNA Negative Control is a siRNA of 21 nucleotides, and can be used as a negative control. SiRNA Negative Control has no homology to most known gene sequence. SiRNA Negative Control can be used in human, mouse and rat cells in vitro. SiRNA Negative Control can be used as experimental control benchmark, verification of experimental reliability and standardization reference. SiRNA Negative Control is a common negative control used in most research articles.

Molecular Weight

13323.03

Appearance

Solid

Color

White to off-white

SMILES

[RNA, (UUCUCCGAACGUGUCACGUUU), complex with RNA, (ACGUGACACGUUCGGAGAAUU) (1:1)]

Shipping

Room temperature in continental US; may vary elsewhere.

Storage

-20°C, sealed storage, away from moisture

*In solvent : -80°C, 6 months; -20°C, 1 month (sealed storage, away from moisture)

Solvent & Solubility
In Vitro: 

H2O : 100 mg/mL (7.51 mM; Need ultrasonic)

Preparing
Stock Solutions
Concentration Solvent Mass 1 mg 5 mg 10 mg
1 mM 0.0751 mL 0.3753 mL 0.7506 mL
5 mM 0.0150 mL 0.0751 mL 0.1501 mL
View the Complete Stock Solution Preparation Table

* Please refer to the solubility information to select the appropriate solvent. Once prepared, please aliquot and store the solution to prevent product inactivation from repeated freeze-thaw cycles.
Storage method and period of stock solution: -80°C, 6 months; -20°C, 1 month (sealed storage, away from moisture). When stored at -80°C, please use it within 6 months. When stored at -20°C, please use it within 1 month.

* Note: If you choose water as the stock solution, please dilute it to the working solution, then filter and sterilize it with a 0.22 μm filter before use.

  • Molarity Calculator

  • Dilution Calculator

Mass (g) = Concentration (mol/L) × Volume (L) × Molecular Weight (g/mol)

Mass
=
Concentration
×
Volume
×
Molecular Weight *

Concentration (start) × Volume (start) = Concentration (final) × Volume (final)

This equation is commonly abbreviated as: C1V1 = C2V2

Concentration (start)

C1

×
Volume (start)

V1

=
Concentration (final)

C2

×
Volume (final)

V2

In Vivo Dissolution Calculator
Please enter the basic information of animal experiments:

Dosage

mg/kg

Animal weight
(per animal)

g

Dosing volume
(per animal)

μL

Number of animals

Recommended: Prepare an additional quantity of animals to account for potential losses during experiments.
Calculation results:
Working solution concentration: mg/mL
This product has good water solubility, please refer to the measured solubility data in water/PBS/Saline for details.
The concentration of the stock solution you require exceeds the measured solubility. The following solution is for reference only.If necessary, please contact MedChemExpress (MCE).
Purity & Documentation

Purity: 96.40%

Complete Stock Solution Preparation Table

* Please refer to the solubility information to select the appropriate solvent. Once prepared, please aliquot and store the solution to prevent product inactivation from repeated freeze-thaw cycles.
Storage method and period of stock solution: -80°C, 6 months; -20°C, 1 month (sealed storage, away from moisture). When stored at -80°C, please use it within 6 months. When stored at -20°C, please use it within 1 month.

Optional Solvent Concentration Solvent Mass 1 mg 5 mg 10 mg 25 mg
H2O 1 mM 0.0751 mL 0.3753 mL 0.7506 mL 1.8764 mL
5 mM 0.0150 mL 0.0751 mL 0.1501 mL 0.3753 mL

* Note: If you choose water as the stock solution, please dilute it to the working solution, then filter and sterilize it with a 0.22 μm filter before use.

  • No file chosen (Maximum size is: 1024 Kb)
  • If you have published this work, please enter the PubMed ID.
  • Your name will appear on the site.
Help & FAQs
  • Do most proteins show cross-species activity?

    Species cross-reactivity must be investigated individually for each product. Many human cytokines will produce a nice response in mouse cell lines, and many mouse proteins will show activity on human cells. Other proteins may have a lower specific activity when used in the opposite species.

Your Recently Viewed Products:

Inquiry Online

Your information is safe with us. * Required Fields.

Product Name

 

Requested Quantity *

Applicant Name *

 

Salutation

Email Address *

 

Phone Number *

Department

 

Organization Name *

City

State

Country or Region *

     

Remarks

Bulk Inquiry

Inquiry Information

Product Name:
SiRNA Negative Control
Cat. No.:
HY-150150
Quantity:
MCE Japan Authorized Agent: