1. Immunology/Inflammation
  2. Toll-like Receptor (TLR)
  3. DSP30

DSP30 is a phosphorothioate cpG-oligodeoxynucleotide and a TLR9 agonist. DSP30 can activate immune system cells, including B cells and dendritic cells, by inducing proliferation and cytokine production.DSP30 can enhance the immunosuppressive function of bone marrow-multipotent mesenchymal stromal cells (BM-MSC). DSP30 combined with interleukin 2 (IL2) is an effective mitotic stimulant in B-cell disorders. DSP30 can be used for the genetic characteristic research and analysis of chronic lymphocytic leukemia (CLL).

For research use only. We do not sell to patients.

Gene Regulation Tool

TCGTCGCTGTCTCCGCTTCTTCTTGCC

DSP30 Chemical Structure

Size Stock
50 mg   Get quote  
100 mg   Get quote  
250 mg   Get quote  

* Please select Quantity before adding items.

This product is a controlled substance and not for sale in your territory.

Top Publications Citing Use of Products

View All Toll-like Receptor (TLR) Isoform Specific Products:

  • Biological Activity

  • Purity & Documentation

  • References

  • Customer Review

Description

DSP30 is a phosphorothioate cpG-oligodeoxynucleotide and a TLR9 agonist. DSP30 can activate immune system cells, including B cells and dendritic cells, by inducing proliferation and cytokine production.DSP30 can enhance the immunosuppressive function of bone marrow-multipotent mesenchymal stromal cells (BM-MSC). DSP30 combined with interleukin 2 (IL2) is an effective mitotic stimulant in B-cell disorders. DSP30 can be used for the genetic characteristic research and analysis of chronic lymphocytic leukemia (CLL)[1][2][3][4][5].

In Vitro

DSP30 (1 μM, 5 days) enhances the immunosuppressive function of BM-MSCs by promoting their proliferation, upregulating anti-inflammatory factors such as TGF-β1, maintaining high expression of IFN-γ and IL-10 in co-cultured T cells, and increasing the level of adenosine[1].
DSP30 (10 μg/mL, 5 days) enables CRTH2+ allergen-stimulated TH2 cells to produce IFN-γ[4].
DSP30 (0.1-1 μM, 0-72 h) significantly upregulates the expression of CD25 in B-CLL cells[5].
DSP30 (0.01-1 μM, 48-120 h) significantly enhances the killing effect of LMB-2 on B-CLL cells[5].

MedChemExpress (MCE) has not independently confirmed the accuracy of these methods. They are for reference only.

RT-PCR[1]

Cell Line: BM-MSC, T lymphocytes
Concentration: 1 μM
Incubation Time: 5 days
Result: Had no impact on the expression of the inflammatory cytokine IL-6.
Induced the expression of IL-1β, IL-8 and TGF-β1.
Led to a significant increase in IL-8 and VCAM expression levels with LSP (HY-D1056) stimulation.
Maintained the high expression of IFN-γ and IL-10 in T cells with upregulated BM-MSC.

Cell Viability Assay[5]

Cell Line: B-CLL cells
Concentration: 1 μM
Incubation Time: 5 days
Result: Significantly enhanced the sensitivity of B-CLL cells to LMB-2.
Enabled the originally drug-resistant B-CLL cells to reach the clinically achievable IC50 level.
SMILES

[TCGTCGCTGTCTCCGCTTCTTCTTGCCH]

Shipping

Room temperature in continental US; may vary elsewhere.

Storage

Please store the product under the recommended conditions in the Certificate of Analysis.

Purity & Documentation
References
  • No file chosen (Maximum size is: 1024 Kb)
  • If you have published this work, please enter the PubMed ID.
  • Your name will appear on the site.
  • Molarity Calculator

  • Dilution Calculator

The molarity calculator equation

Mass (g) = Concentration (mol/L) × Volume (L) × Molecular Weight (g/mol)

Mass   Concentration   Volume   Molecular Weight *
= × ×

The dilution calculator equation

Concentration (start) × Volume (start) = Concentration (final) × Volume (final)

This equation is commonly abbreviated as: C1V1 = C2V2

Concentration (start) × Volume (start) = Concentration (final) × Volume (final)
× = ×
C1   V1   C2   V2
Help & FAQs
  • Do most proteins show cross-species activity?

    Species cross-reactivity must be investigated individually for each product. Many human cytokines will produce a nice response in mouse cell lines, and many mouse proteins will show activity on human cells. Other proteins may have a lower specific activity when used in the opposite species.

Your Recently Viewed Products:

Inquiry Online

Your information is safe with us. * Required Fields.

Product Name

 

Requested Quantity *

Applicant Name *

 

Salutation

Email Address *

 

Phone Number *

Department

 

Organization Name *

City

State

Country or Region *

     

Remarks

Bulk Inquiry

Inquiry Information

Product Name:
DSP30
Cat. No.:
HY-177058
Quantity:
MCE Japan Authorized Agent: