2. Immunology/Inflammation
  3. Toll-like Receptor (TLR)
  4. DSP30

DSP30 is a phosphorothioate cpG-oligodeoxynucleotide and a TLR9 agonist. DSP30 can activate immune system cells, including B cells and dendritic cells, by inducing proliferation and cytokine production.DSP30 can enhance the immunosuppressive function of bone marrow-multipotent mesenchymal stromal cells (BM-MSC). DSP30 combined with interleukin 2 (IL2) is an effective mitotic stimulant in B-cell disorders. DSP30 can be used for the genetic characteristic research and analysis of chronic lymphocytic leukemia (CLL).

For research use only. We do not sell to patients.

TCGTCGCTGTCTCCGCTTCTTCTTGCC

DSP30 Chemical Structure

Size Stock
50 mg   Get quote  
100 mg   Get quote  
250 mg   Get quote  

* Please select Quantity before adding items.

This product is a controlled substance and not for sale in your territory.

DSP30 Related Antibodies

Top Publications Citing Use of Products

View All Toll-like Receptor (TLR) Isoform Specific Products:

View All Isoforms
TLR3 TLR8 TLR9 TLR2 TLR4 TLR7 TLR1 TLR6

  • Biological Activity

  • Purity & Documentation

  • References

  • Customer Review

Description

DSP30 is a phosphorothioate cpG-oligodeoxynucleotide and a TLR9 agonist. DSP30 can activate immune system cells, including B cells and dendritic cells, by inducing proliferation and cytokine production.DSP30 can enhance the immunosuppressive function of bone marrow-multipotent mesenchymal stromal cells (BM-MSC). DSP30 combined with interleukin 2 (IL2) is an effective mitotic stimulant in B-cell disorders. DSP30 can be used for the genetic characteristic research and analysis of chronic lymphocytic leukemia (CLL)[1][2][3][4][5].

In Vitro

DSP30 (1 μM, 5 days) enhances the immunosuppressive function of BM-MSCs by promoting their proliferation, upregulating anti-inflammatory factors such as TGF-β1, maintaining high expression of IFN-γ and IL-10 in co-cultured T cells, and increasing the level of adenosine[1].
DSP30 (10 μg/mL, 5 days) enables CRTH2+ allergen-stimulated TH2 cells to produce IFN-γ[4].
DSP30 (0.1-1 μM, 0-72 h) significantly upregulates the expression of CD25 in B-CLL cells[5].
DSP30 (0.01-1 μM, 48-120 h) significantly enhances the killing effect of LMB-2 on B-CLL cells[5].

MedChemExpress (MCE) has not independently confirmed the accuracy of these methods. They are for reference only.

DSP30 Related Antibodies

RT-PCR[1]

Cell Line: BM-MSC, T lymphocytes
Concentration: 1 μM
Incubation Time: 5 days
Result: Had no impact on the expression of the inflammatory cytokine IL-6.
Induced the expression of IL-1β, IL-8 and TGF-β1.
Led to a significant increase in IL-8 and VCAM expression levels with LSP stimulation.
Maintained the high expression of IFN-γ and IL-10 in T cells with upregulated BM-MSC.

Cell Viability Assay[5]

Cell Line: B-CLL cells
Concentration: 1 μM
Incubation Time: 5 days
Result: Significantly enhance the sensitivity of B-CLL cells to LMB-2.
Enable the originally drug-resistant B-CLL cells to reach the clinically achievable IC50 level.
SMILES

[TCGTCGCTGTCTCCGCTTCTTCTTGCCH]
Shipping

Room temperature in continental US; may vary elsewhere.
Storage

Please store the product under the recommended conditions in the Certificate of Analysis.
Purity & Documentation
References
  • No file chosen (Maximum size is: 1024 Kb)
  • If you have published this work, please enter the PubMed ID.
  • Your name will appear on the site.

DSP30 Related Classifications

  • Molarity Calculator

  • Dilution Calculator

The molarity calculator equation

Mass (g) = Concentration (mol/L) × Volume (L) × Molecular Weight (g/mol)

Mass   Concentration   Volume   Molecular Weight *
= × ×

The dilution calculator equation

Concentration (start) × Volume (start) = Concentration (final) × Volume (final)

This equation is commonly abbreviated as: C1V1 = C2V2

Concentration (start) × Volume (start) = Concentration (final) × Volume (final)
× = ×
C1   V1   C2   V2
Help & FAQs
  • Do most proteins show cross-species activity?

    Species cross-reactivity must be investigated individually for each product. Many human cytokines will produce a nice response in mouse cell lines, and many mouse proteins will show activity on human cells. Other proteins may have a lower specific activity when used in the opposite species.

Keywords:

DSP30DSP 30DSP-30Toll-like Receptor (TLR)OligonucleotideBM-MSCIL2B-cell disorderImmunosuppressionInhibitorinhibitorinhibit

Your Recently Viewed Products:

Inquiry Online

Your information is safe with us. * Required Fields.

Product Name

  

Requested Quantity *

Applicant Name *

 

Salutation

Email Address *

 

Phone Number *

Department

 

Organization Name *

City

State

Country or Region *

      

Remarks

Bulk Inquiry

Inquiry Information

Product Name:
DSP30
Cat. No.:
HY-177058
Quantity:
MCE Japan Authorized Agent:

Customer Review

Thank You for Your Feedback!

Request for HNMR Report

Please fill out this form to request the QC report. We will send it to your Email address shortly.

Your information is safe with us. * Required Fields.

Product Name

  

Lot #

Applicant Name *

 

Email Address *

Phone Number

 

Department *

Organization Name *

 

Country or Region *

Remarks

SAFETY DATA SHEET (SDS)

Request for HNMR Report

We have received your request and will respond to you as soon as possible.