2. Infection

Infection

Infection

Related Products

PDF 70.44 MB

Infection is a pathophysiological process that involves the invasion and colonization of a living organism (host) by disease-causing infectious agents, the reaction of host tissues to these agents and the toxins they produce, and the transmission of infectious agents to other hosts. Common infectious agents include viruses, viroids, prions, bacteria, nematodes, arthropods, and other macroparasites such as tapeworms. Hosts can fight infections using their immune system. Mammals often engage both innate and adaptive immune systems to eliminate infectious agents or inhibit their growth and transmission. When infection occurs, anti-infective drugs can suppress the infection. Several broad types of anti-infective drugs exist, depending on the type of organism targeted; they include antibacterial (antibiotic), antiviral, antifungal and antiparasitic agents.

Cat. No. Product Name CAS No. Purity Chemical Structure
  • HY-105048
    Omiganan 204248-78-2 98.64%
    Omiganan is a cationic antimicrobial peptide. Omiganan as an analogue of indolicidin shows activity against gram-positive and gram-negative bacteria but also Candida spp. isolates. Omiganan can be used for the research of alcohol nose and acne.
    Omiganan
  • HY-107813
    Amikacin sulfate 149022-22-0 99.11%
    Amikacin sulfate (BAY 41-6551 sulfate) is an aminoglycoside antibiotic and a semisynthetic analog of kanamycin. Amikacin sulfate is bactericidal, acting directly on the 30S and 50S bacerial ribosomal subunits to inhibit protein synthesis. Amikacin sulfate is very active against most Gram-negative bacteria including gentamicin- and tobramycin-resistant strains. Amikacin sulfate also inhibits the infections caused by susceptible Nocardia and nontuberculous mycobacteria.
    Amikacin sulfate
  • HY-126428
    ZL0580 2377151-10-3 99.26%
    ZL0580, a structurally close analog of ZL0590, induces epigenetic suppression of HIV via selectively binding to BD1 domain of BRD4. ZL0580 induces HIV suppression by inhibiting Tat transactivation and transcription elongation as well as by inducing repressive chromatin structure at the HIV promoter.
    ZL0580
  • HY-12361
    PF 1022A 133413-70-4 99.12%
    PF 1022A is a cyclooctadepsipeptide with broadspectrum anthelmintic properties produced by fermentation of the fungus Mycelia sterilia. PF 1022A is a channel-forming ionophore. PF 1022A showes strong anthelmintic activities against Ascaridia galli in chickens. PF 1022A also can be used for angiostrongyliasis research.
    PF 1022A
  • HY-B0466
    Cloxacillin sodium monohydrate 7081-44-9 99.37%
    Cloxacillin sodium monohydrate is an orally active antibacterial agent and β-lactamase inhibitor with an IC50 of 0.04 µM. Cloxacillin sodium monohydrate can suppress the S. aureus-induced inflammatory response by inhibiting the activation of MAPKs, NF-кB and NLRP3-related proteins.
    Cloxacillin sodium monohydrate
  • HY-B1118
    Secnidazole 3366-95-8 99.87%
    Secnidazole (RP-14539) is an orally active azole antibiotic and a imidazole mitigator of Serratia marcescens virulence. Secnidazole, as an analog of acylhomoserine lactones, effectively inhibits QS resulting in the attenuation of Pseudomonas aeruginosa pathogenesis. Secnidazole has antimicrobial activity against many anaerobic Gram-negative and Gram-positive bacterial species in vitro. Secnidazole can be used for the research of various diseases, such as amoebiasis and giardiasis, and bacterial vaginitis.
    Secnidazole
  • HY-P9932
    Obiltoxaximab 1351337-07-9 ≥99.0%
    Obiltoxaximab (ETI 204) is the second and potent anti-protective antigen (PA) monoclonal antibody with immunogenicity. Obiltoxaximab plays a central role in anthrax toxin assembly and target cell intoxication, promoting survival, and inhibiting bacterial spread to the periphery in animal models. Obiltoxaximab can be used in the research of inhalational anthrax, bacteremia and toxemia.
    Obiltoxaximab
  • HY-115440
    CRS3123 dihydrochloride 1013915-99-5 99.18%
    CRS3123 (REP-3123) dihydrochloride, a fully synthetic antibacterial agent, potently inhibits methionyl-tRNA synthetase (MetRS) of Clostridioides difficile, inhibiting Clostridioides difficile toxin production and spore formation. CRS3123 dihydrochloride is an oral agent for the research of Clostridioides difficile infection (CDI).
    CRS3123 dihydrochloride
  • HY-138078
    Lufotrelvir 2468015-78-1 99.87%
    Lufotrelvir (PF-07304814), a phosphate proagent of PF-00835231, acts as a potent 3CLpro protease (Mpro) inhibitor with SARS-CoV-2 antiviral activity. Lufotrelvir binds and inhibits SARS-CoV-2 3CLpro activity with a Ki of 174nM. Lufotrelvir is promising single antiviral agent and also can be used for the research of combination with other antivirals that target other critical stages of the coronavirus life cycle.
    Lufotrelvir
  • HY-147217
    Bepirovirsen 1403787-62-1 98.44%
    Bepirovirsen is an antisense oligonucleotide targeting all HBV messenger RNAs. Bepirovirsen leads to reductions in HBV-derived RNAs, HBV DNA and viral proteins. Bepirovirsen can be used for the research of chronic HBV infection. Bepirovirsen binding site sequence (GCACTTCGCTTCACCTCTGC).
    Bepirovirsen
  • HY-17605A
    Bictegravir sodium 1807988-02-8 99.10%
    Bictegravir sodium is a potent inhibitor of HIV-1 integrase, with an IC50 of 7.5 nM. Bictegravir sodium exhibits potent and selective anti-HIV activity and low cytotoxicity.
    Bictegravir sodium
  • HY-P99520
    Vilobelimab 2250440-41-4 99.95%
    Vilobelimab (CaCP-29, IFX-1) is a monoclonal anti-C5a antibody to the allergen C5a, a pro-inflammatory complement division product that plays a central role in mediating organ dysfunction. Vilobelimab acts as a C5a inhibitor, inhibiting neutrophil activation, chemotaxis, and reducing inflammatory signalling, and may be used in studies related to sepsis, COVID-19, etc.
    Vilobelimab
  • HY-17426
    Famciclovir 104227-87-4 99.69%
    Famciclovir (BRL 42810) is an orally active nucleoside analogue. Famciclovir is an antiviral agent with potent activities against HBV, HSV and VZV. Famciclovir can be used for the research of herpesvirus infection.
    Famciclovir
  • HY-17519
    Novaluron 116714-46-6 99.51%
    Novaluron is a chemical with insecticide properties, an insect growth regulator, and has adverse effects on mouse sperm.
    Novaluron
  • HY-B0506
    Nadifloxacin 124858-35-1 99.88%
    Nadifloxacin(OPC7251) is a topical fluoroquinolone antibiotic for the treatment of acne vulgaris.
    Nadifloxacin
  • HY-B1217
    Bronopol 52-51-7 ≥98.0%
    Bronopol is an antibacterial agent with low toxicity (to mammals) and high activity (especially against Gram-negative bacteria). Bronopol oxidizes protein thiols, inhibits enzymatic activity, and exhibits antibacterial activity. Bronopol is also a formaldehyde releaser.
    Bronopol
  • HY-B1297
    Ceforanide 60925-61-3 99.23%
    Ceforanide is a second generation cephalosporin administered intravenously or intramuscularly. Ceforanide has a spectrum of in vitro antibacterial activity.
    Ceforanide
  • HY-B1513
    α-Cyclodextrin 10016-20-3 99.82%
    α-Cyclodextrin (α-CD) is a soluble fiber derived from corn. α-Cyclodextrin can deplete sphingolipids and phospholipids from cell membranes. α-Cyclodextrin interacts with tubulin. α-Cyclodextrin improves defenses against SARS-CoV-2 infection. α-Cyclodextrin enhances the anticancer efficacy of Crcumin (HY-N0005) against breast, lung and cervical cancer. α-Cyclodextrin has beneficial effects on body weight and blood lipids.
    α-Cyclodextrin
  • HY-B1526
    Thiacetazone 104-06-3 99.73%
    Thiacetazone (Thioacetazone) is a thiourea-containing antitubercular agent and is an orally active antibiotic. Thiacetazone has antibacterial action, which inhibits growth of Mycobacterium tuberculosis H37Rv with a MIC value of 0.1 μg/mL.
    Thiacetazone
  • HY-B2117
    Valpromide 2430-27-5 ≥98.0%
    Valpromide is an amide derivative of Valproic acid (HY-10585) and an orally active epoxide hydrolase inhibitor that can cross the blood-brain barrier. Valpromide has antiepileptic, anticonvulsant, and antipsychotic effects. Valpromide also exhibits antiviral activity and can inhibit the reactivation of the EBV lytic cycle.
    Valpromide
Cat. No. Product Name / Synonyms Application Reactivity