2. Infection

Infection

Infection

Related Products

PDF 70.44 MB

Infection is a pathophysiological process that involves the invasion and colonization of a living organism (host) by disease-causing infectious agents, the reaction of host tissues to these agents and the toxins they produce, and the transmission of infectious agents to other hosts. Common infectious agents include viruses, viroids, prions, bacteria, nematodes, arthropods, and other macroparasites such as tapeworms. Hosts can fight infections using their immune system. Mammals often engage both innate and adaptive immune systems to eliminate infectious agents or inhibit their growth and transmission. When infection occurs, anti-infective drugs can suppress the infection. Several broad types of anti-infective drugs exist, depending on the type of organism targeted; they include antibacterial (antibiotic), antiviral, antifungal and antiparasitic agents.

Cat. No. Product Name CAS No. Purity Chemical Structure
  • HY-126428
    ZL0580 2377151-10-3 99.26%
    ZL0580, a structurally close analog of ZL0590, induces epigenetic suppression of HIV via selectively binding to BD1 domain of BRD4. ZL0580 induces HIV suppression by inhibiting Tat transactivation and transcription elongation as well as by inducing repressive chromatin structure at the HIV promoter.
    ZL0580
  • HY-13735
    Quinacrine 83-89-6 98.20%
    Quinacrine (Acriquine) is an antimalarial and anti-cancer agent. Quinacrine also inhibits human aldehyde oxidase (IC50: 3.3 μM). Quinacrine has affinity for nucleic acids, and stains DNA and RNA in fixed cells (Ex/Em: 436/525 nm).
    Quinacrine
  • HY-B0466
    Cloxacillin sodium monohydrate 7081-44-9 99.37%
    Cloxacillin sodium monohydrate is an orally active antibacterial agent and β-lactamase inhibitor with an IC50 of 0.04 µM. Cloxacillin sodium monohydrate can suppress the S. aureus-induced inflammatory response by inhibiting the activation of MAPKs, NF-кB and NLRP3-related proteins.
    Cloxacillin sodium monohydrate
  • HY-B1118
    Secnidazole 3366-95-8 99.87%
    Secnidazole (RP-14539) is an orally active azole antibiotic and a imidazole mitigator of Serratia marcescens virulence. Secnidazole, as an analog of acylhomoserine lactones, effectively inhibits QS resulting in the attenuation of Pseudomonas aeruginosa pathogenesis. Secnidazole has antimicrobial activity against many anaerobic Gram-negative and Gram-positive bacterial species in vitro. Secnidazole can be used for the research of various diseases, such as amoebiasis and giardiasis, and bacterial vaginitis.
    Secnidazole
  • HY-P9932
    Obiltoxaximab 1351337-07-9 ≥99.0%
    Obiltoxaximab (ETI 204) is the second and potent anti-protective antigen (PA) monoclonal antibody with immunogenicity. Obiltoxaximab plays a central role in anthrax toxin assembly and target cell intoxication, promoting survival, and inhibiting bacterial spread to the periphery in animal models. Obiltoxaximab can be used in the research of inhalational anthrax, bacteremia and toxemia.
    Obiltoxaximab
  • HY-10571A
    Delavirdine mesylate 147221-93-0 99.82%
    Delavirdine (U 90152) mesylate is a potent, highly specific and orally active non-nucleoside reverse transcriptase inhibitor (NNRTI). Delavirdine mesylate selectively inhibits HIV-1 reverse transcriptase (RT) (IC50=0.26 μM) over DNA polymerase α (IC50=440 μM) and polymerase δ (IC50>550 μM). Delavirdine mesylate is an inhibitor of HIV-1 replication and can can be used for the study of AIDs.
    Delavirdine mesylate
  • HY-128357
    Ibezapolstat 1275582-97-2 ≥98.0%
    Ibezapolstat (ACX-362E) is a first-in-class, orally active DNA polymerase IIIC (pol IIIC) inhibitor, with a Ki of 0.325 μM for the DNA pol IIIC from C. difficile. Ibezapolstat is developed for the research of C. difficile infection(CDI).
    Ibezapolstat
  • HY-138078
    Lufotrelvir 2468015-78-1 99.87%
    Lufotrelvir (PF-07304814), a phosphate proagent of PF-00835231, acts as a potent 3CLpro protease (Mpro) inhibitor with SARS-CoV-2 antiviral activity. Lufotrelvir binds and inhibits SARS-CoV-2 3CLpro activity with a Ki of 174nM. Lufotrelvir is promising single antiviral agent and also can be used for the research of combination with other antivirals that target other critical stages of the coronavirus life cycle.
    Lufotrelvir
  • HY-147217
    Bepirovirsen 1403787-62-1 98.44%
    Bepirovirsen is an antisense oligonucleotide targeting all HBV messenger RNAs. Bepirovirsen leads to reductions in HBV-derived RNAs, HBV DNA and viral proteins. Bepirovirsen can be used for the research of chronic HBV infection. Bepirovirsen binding site sequence (GCACTTCGCTTCACCTCTGC).
    Bepirovirsen
  • HY-150168
    TH-Z145 2260887-57-6
    TH-Z145, a lipophilic bisphosphonate, is a FPPS inhibitor (IC50: 210 nM).
    TH-Z145
  • HY-17605A
    Bictegravir sodium 1807988-02-8 99.10%
    Bictegravir sodium is a potent inhibitor of HIV-1 integrase, with an IC50 of 7.5 nM. Bictegravir sodium exhibits potent and selective anti-HIV activity and low cytotoxicity.
    Bictegravir sodium
  • HY-P99277
    Actoxumab 1245634-25-6 99.52%
    Actoxumab (Anti-C. difficile Toxin A Recombinant Antibody) is a antitoxin antibody against C. difficile toxin A by neutralizing TcdA. Actoxumab prevents both the damage to the gut wall and the inflammatory response, which are associated with C. difficile. Actoxumab has synergy effect with Bezlotoxumab (HY-P9929) targeting TcdB.
    Actoxumab
  • HY-P99520
    Vilobelimab 2250440-41-4 99.95%
    Vilobelimab (CaCP-29, IFX-1) is a monoclonal anti-C5a antibody to the allergen C5a, a pro-inflammatory complement division product that plays a central role in mediating organ dysfunction. Vilobelimab acts as a C5a inhibitor, inhibiting neutrophil activation, chemotaxis, and reducing inflammatory signalling, and may be used in studies related to sepsis, COVID-19, etc.
    Vilobelimab
  • HY-P99697
    Leronlimab 674782-26-4
    Leronlimab (PRO 140) is a humanized IgG4 anti-CCR5 monoclonal antibody. Leronlimab inhibits CCR5-mediated HIV-1 viral and lung metastasis in mouse tumor models. Leronlimab can be used for the research of HIV nonalcoholic steatohepatitis (NASH) and cancer.
    Leronlimab
  • HY-P2454
    CSP1 172889-49-5 98.26%
    CSP1 is a potent and selective ComD1 receptor agonist, with an IC50 of 10.3 nM. CSP1 is a major variants of competence-stimulating peptide (CSP), and it can regulate genetic transformation of S. pneumonia by modulating quorum sensing (QS). CSP1 can act as an antibacterial agent.
    CSP1
  • HY-12642
    Diethylcarbamazine citrate 1642-54-2 99.95%
    Diethylcarbamazine citrate is an orally active anthropoidal compound. Diethylcarbamazine citrate is an inhibitor of arachidonic acid metabolism of filaria microfilaria. Diethylcarbamazine citrate has anti-inflammatory and antiparasitic activity.
    Diethylcarbamazine citrate
  • HY-14282
    Lanoconazole 101530-10-3 98.00%
    Lanoconazole is a potent and orally active imidazole antifungal agent, shows a broad spectrum of activity against fungi?in vitro?and?in vivo. Lanoconazole interferes with ergosterol biosynthesis by inhibiting sterol 14-alpha demethylase and blocking fungal membrane ergosterol biosynthesis. Lanoconazole can be used for the investigation of dermatophytosis and onychomycosis.
    Lanoconazole
  • HY-17426
    Famciclovir 104227-87-4 99.69%
    Famciclovir (BRL 42810) is an orally active nucleoside analogue. Famciclovir is an antiviral agent with potent activities against HBV, HSV and VZV. Famciclovir can be used for the research of herpesvirus infection.
    Famciclovir
  • HY-18219
    Walrycin B 878419-78-4 98.38%
    Walrycin B, an analogue of toxoflavin, is a potent SARS-CoV-2 3CLpro inhibitor with an IC50 of 0.26 μM. Walrycin B is a WalR response regulator inhibitor. Walrycin B has potent activity of inhibiting bacteria growth.
    Walrycin B
  • HY-A0214
    Colistin methanesulfonate sodium salt 8068-28-8 ≥99.0%
    Colistin methanesulfonate sodium salt exhibits MIC values ranged from 4 to 16 mg/liter against susceptible strains (P. aeruginosa).
    Colistin methanesulfonate sodium salt
Cat. No. Product Name / Synonyms Application Reactivity