2. Infection

Infection

Infection

Related Products

PDF 70.44 MB

Infection is a pathophysiological process that involves the invasion and colonization of a living organism (host) by disease-causing infectious agents, the reaction of host tissues to these agents and the toxins they produce, and the transmission of infectious agents to other hosts. Common infectious agents include viruses, viroids, prions, bacteria, nematodes, arthropods, and other macroparasites such as tapeworms. Hosts can fight infections using their immune system. Mammals often engage both innate and adaptive immune systems to eliminate infectious agents or inhibit their growth and transmission. When infection occurs, anti-infective drugs can suppress the infection. Several broad types of anti-infective drugs exist, depending on the type of organism targeted; they include antibacterial (antibiotic), antiviral, antifungal and antiparasitic agents.

Cat. No. Product Name CAS No. Purity Chemical Structure
  • HY-128554
    N-Desethyl amodiaquine 79352-78-6 ≥98.0%
    N-Desethyl amodiaquine is the biologically active metabolite of Amodiaquine (HY-B1322A). N-Desethyl amodiaquine is an antiparasitic agent, has inhibitory for strains V1/S and 3D7 with IC50 values of 97 nM and 25 nM, respectively. N-Desethyl amodiaquine can be used for the research of malaria.
    N-Desethyl amodiaquine
  • HY-135747
    Gut restricted-7 2553218-46-3 ≥98.0%
    Gut restricted-7 (GR-7) is a potent, covalent and orally active pan-bile salt hydrolase (BSH) inhibitor. Gut restricted-7 has a tissue-selective and is restricted to the gut. Gut restricted-7 decreases gut bacterial BSHs and decreases deconjugated bile acid levels in feces of mice.
    Gut restricted-7
  • HY-171006
    IRF1-IN-1 701225-07-2 99.72%
    IRF1-IN-1 (Compound I-2) is an IRF1 inhibitor. IRF1-IN-1 decreases the recruitment of IRF1 to the promoter of CASP1. IRF1-IN-1 inhibits cell death signaling pathway (i.e., cleavage of Caspase 1, GSDMD, IL-1 and PARP1). IRF1-IN-1 has a protective effect on ionizing radiation-induced inflammatory skin injury.
    IRF1-IN-1
  • HY-B0334A
    Sulbactam sodium 69388-84-7 99.66%
    Sulbactam (CP45899) sodium is a competitive, irreversible beta-lactamase inhibitor. Sulbactam sodium shows antimicrobial activity against multidrug-resistant (MDR) acinetobacter calcoaceticus--Acinetobacter baumannii (Acb) complex.
    Sulbactam sodium
  • HY-P99209
    Motavizumab 677010-34-3 99.17%
    Motavizumab (MEDI-524) is an anti-human RSV (respiratory syncytial virus) monoclonal antibody. Motavizumab can be used in respiratory syncytial virus infection in high-risk infants research.
    Motavizumab
  • HY-136548B
    Tenofovir diphosphate disodium 2738719-07-6 99.42%
    Tenofovir diphosphate disodium is an antiretroviral agent and an inhibitor of DNA polymerases. Tenofovir diphosphate disodium is a substrate of HIV-1 reverse transcriptase (RT). Tenofovir diphosphate disodium can be used for the research of Aids.
    Tenofovir diphosphate disodium
  • HY-141619A
    Cotrimoxazole (Trimethoprim/sulfamethoxazole 1:19) 8064-90-2 99.87%
    Cotrimoxazole (Trimethoprim/sulfamethoxazole 1:19), an antimicrobial agent, is a Trimethoprim and Sulfamethoxazole mixture. The ratio of Trimethoprim to Sulfamethoxazole in the combination mixture is 1 : 19.
    Cotrimoxazole (Trimethoprim/sulfamethoxazole 1:19)
  • HY-160229
    ssRNA40 sodium
    ssRNA40 (sodium) is a 20-mer phosphothioate protected single-stranded RNA oligonucleotide. ssRNA40 is a uridine-rich ssRNA derived from the HIV-1 long terminal repeat on activation of NK cells via TLR7/8[1][2].
    ssRNA40 sodium
  • HY-B0766
    Bicyclol 118159-48-1 99.91%
    Bicyclol (SY801) is an orally active derivative of the traditional Chinese medicine Schisandra chinensis, which has antiviral, anti-inflammatory, immunomodulatory, antioxidant, anti-steatosis, anti-fibrotic and anti-tumor activities. Bicyclol regulates the expression of heat shock proteins and plays an anti-apoptosis role in hepatocytes. Bicyclol reduces the activation of NF-κB and the levels of inflammatory factors in hepatocytes infected with hepatitis C virus (HCV) by inhibiting the activation of the ROS-MAPK-NF-κB pathway, and prevents ferroptosis in acute liver injury. Bicyclol can change the expression of Mdr-1, GSH/GST and Bcl-2, increase the intracellular concentration of anticancer drugs, and sensitize drug-resistant cells to anticancer drugs. Bicyclol inhibits the proliferation of human malignant hepatoma cells by regulating the PI3K/AKT pathway and the Ras/Raf/MEK/ERK pathway. Bicyclol can be used in the study of chronic hepatitis, acute liver injury, nonalcoholic fatty liver disease, liver fibrosis and hepatocellular carcinoma.
    Bicyclol
  • HY-B1374
    Florfenicol 73231-34-2 99.64%
    Florfenicol ((-)-Florfenicol) is an orally active broad-spectrum antibacterial antibiotic with anti-inflammatory, pro apoptotic, and immunomodulatory functions[6][7].
    Florfenicol
  • HY-17425A
    Valacyclovir hydrochloride 124832-27-5 99.85%
    Valacyclovir hydrochloride (Valaciclovir hydrochloride) is an orally active antiviral agent for herpes simplex, herpes zoster, and herpes B. Valacyclovir hydrochloride inhibits HSV-1 W (50=2.9 μg/ml). Valacyclovir hydrochloride is a proagent of Aciclovir (HY-17422) .
    Valacyclovir hydrochloride
  • HY-147217A
    Bepirovirsen sodium 2563929-84-8 98.44%
    Bepirovirsen (ISIS 505358) sodium is an antisense oligonucleotide targeting all HBV messenger RNAs. Bepirovirsen sodium leads to reductions in HBV-derived RNAs, HBV DNA and viral proteins. Bepirovirsen sodium can be used for the research of chronic HBV infection. Bepirovirsen sodium binding site sequence (GCACTTCGCTTCACCTCTGC).
    Bepirovirsen sodium
  • HY-12651
    Primaquine diphosphate 63-45-6 ≥98.0%
    Primaquine diphosphate is a potent antimalaria agent and a potent gametocytocide in falciparum malaria. Primaquine diphosphate prevents relapse in vivax and ovale malaria.
    Primaquine diphosphate
  • HY-17395
    Terbinafine hydrochloride 78628-80-5 99.86%
    Terbinafine hydrochloride (TDT 067 hydrochloride) is an orally active and potent antifungal agent. Terbinafine hydrochloride is a potent non-competitive inhibitor of squalene epoxidase from Candida, with a Ki of 30 nM. Terbinafine hydrochloride also shows antibacterial activity against certain Gram-positive and Gram-negative bacteria. Terbinafine hydrochloride is a click chemistry reagent, it contains an Alkyne group and can undergo copper-catalyzed azide-alkyne cycloaddition (CuAAc) with molecules containing Azide groups.
    Terbinafine hydrochloride
  • HY-A0059
    Nifuratel 4936-47-4 99.93%
    Nifuratel (NF 113) is an orally active broad-spectrum antibiotic with antiprotozoal, antibacterial, anticancer and anti-inflammatory activities, and has good inhibitory effects on Candida and Trichomonas. Nifuratel is also a STAT3 inhibitor, which significantly inhibits the growth and proliferation of human gastric cancer cells and induces apoptosis. In addition, Nifuratel also inhibits mast cell-mediated antigen hypersensitivity reactions and can be used in the study of IgE-mediated allergic diseases.
    Nifuratel
  • HY-B0249
    Didanosine 69655-05-6 99.45%
    Didanosine (2',3'-Dideoxyinosine; ddI) is a a potent and orally active dideoxynucleoside analogue, and also is a potent nucleoside reverse transcriptase inhibitor. Didanosine shows antiretroviral activity for HIV.
    Didanosine
  • HY-N0216
    Benzoic acid 65-85-0 ≥98.0%
    Benzoic acid is an aromatic alcohol existing naturally in many plants and is a common additive to food, drinks, cosmetics and other products. It acts as preservatives through inhibiting both bacteria and fungi.
    Benzoic acid
  • HY-N0368
    Linalool 78-70-6 ≥98.0%
    Linalool is a natural monoterpene which is a competitive NMDA receptor antagonist. Linalool is orally active and crosses the blood-brain barrier. Linalool has anticancer, antibacterial, anti-inflammatory, neuroprotective, anxiolytic, antidepressant, anti-stress, cardioprotective, hepatoprotective, nephroprotective and pulmonary protective activities.
    Linalool
  • HY-N0447
    8-Gingerol 23513-08-8 99.82%
    8-Gingerol can be found in the rhizome of ginger (Z. officinale) and has oral bioactivity. It activates TRPV1, with an EC50 value of 5.0 µM. 8-Gingerol inhibits COX-2 and also suppresses the growth of H. pylori in vitro. Additionally, 8-Gingerol exhibits anticancer, antioxidant, and anti-inflammatory properties by inhibiting the epidermal growth factor receptor (EGFR) and modulating its downstream STAT3/ERK pathway to suppress the proliferation, migration, and invasion of colorectal cancer cells. 8-Gingerol also exerts immunosuppressive effects by inhibiting oxidative stress, inducing cell cycle arrest, promoting apoptosis, and regulating autophagy. Furthermore, 8-Gingerol has cardioprotective effects. 8-Gingerol is promising for research in the fields of cancer, infection, immunosuppression, and cardiovascular diseases.
    8-Gingerol
  • HY-N0656
    Usnic acid 125-46-2 ≥98.0%
    Usnic acid is a secondary metabolite of lichens with a unique dibenzofuran skeleton. Usnic acid inhibits DNA/RNA synthesis and has antibacterial activity. Usnic acid induces cell cycle arrest and apoptosis and has anticancer activity. Usnic acid inhibits RANKL-mediated osteoclast formation and function by reducing the transcriptional and translational expression of NFATc1. Usnic acid has antioxidant and anti-inflammatory activities by inhibiting lipid peroxidation and myeloperoxidase.
    Usnic acid
Cat. No. Product Name / Synonyms Application Reactivity