From 11:00 pm to 12:00 pm EST ( 8:00 pm to 9:00 pm PST ) on January 6th, the website will be under maintenance. We are sorry for the inconvenience. Please arrange your schedule properly.
TAU-IN-5 (compound 13) is a TAU protein inhibitor with an EC50 of 0.81 μM. TAU-IN-5 inhibits the formation of tau (2N4R isoform) oligomers and reduces the formation of tau dimers. TAU-IN-5 can be used in the study of Alzheimer's disease (AD) and Parkinson's disease (PD) .
TAU-IN-3 (Compound 2) is an orally active TAU inhibitor. TAU-IN-3 inhibits the expression of MAPT exon 10 DDPAC mutant gene in HeLa cells (IC50: 0.6 µM). TAU-IN-3 reduces the 4R/3R MAPT mRNA ratio in HeLa cells transfected with WT or DDPAC minigenes. TAU-IN-3 inhibits the insertion of endogenous MAPT exon 10 and the production of 4R tau protein in cells. TAU-IN-3 modulates tau splicing in htau mice and improves the associated behavioral phenotypes. TAU-IN-3 can be used to study neurodegenerative diseases .
Tau ligand-1 (Compound 75) is a ligand for aggregated tau protein that can penetrate the blood-brain barrier . In tissues from patients with Alzheimer's disease, progressive supranuclear palsy, corticobasal degeneration, and Pick's disease, Tau ligand-1 exhibits high affinity for aggregated tau protein, with equilibrium dissociation constant (KD) values ranging from 1 to 3.8 nM . Tau ligand-1 can serve as a potential positron emission tomography (PET) tracer and holds promise for application in positron emission tomography imaging studies of tau-related diseases in the central nervous system .
τ-Fluvalinate is a broad-spectrum insecticide that is effective against a wide range of insect pests. τ-Fluvalinate is widely used in agriculture to protect crops from insects. The mechanism of τ-Fluvalinate is mainly through interfering with the nervous system of the pest, leading to its death.
Aberrant tau ligand 1 is a ligand for tau proteins with abnormal forms. Aberrant tau ligand 1 can be used for synthesis of PROTAC aberrant Tau degrader QC-01-175 (HY-134850) .
Tau protein (592-597), human TFA is a peptide fragment of human Tau protein. The dysfunction of Tau protein is involved in neurodegeneration and dementia .
Aβ/tau aggregation-IN-1 is a potent Aβ1-42 β-sheets formation and tau aggregation inhibitor. The KD values of Aβ/tau aggregation-IN-1 with Aβ1-42 and tau are 160 μM and 337 μM, respectively. Aβ/tau aggregation-IN-1 can permeate the blood-brain barrier .
Tau-aggregation-IN-3 (compound 9) a Tau protein aggregation inhibitor (TAI). Tau-aggregation-IN-3 shows activity in cell-based aggregation inhibition experiments (EC50=4.816 μM). Tau-aggregation-IN-3 can be used in Alzheimer's disease research .
TauASO-12 (murine) (sodium) is a Tau-lowering antisense oligonucleotide (ASO) for murine use, and it has the potential for the research of Alzheimer Disease. (TauASO-12 sequence – 5′ GCTTTTACTGACCATGCGAG 3′ )
Tau Protein/α-synuclein-IN-2 (Compound 14T) is a blood-brain barrier penetrating tau and α-syn inhibitor. Through its thiourea linker structure, Tau Protein/α-synuclein-IN-2 dose-dependently reduces α-syn oligomerization. In biosensor cells, Tau Protein/α-synuclein-IN-2 prevents the seeding effect of tau aggregation. In the M17D neuroblastoma model, Tau Protein/α-synuclein-IN-2 exhibits anti-inclusion effects. Additionally, Tau Protein/α-synuclein-IN-2 reduces Aβ plaque formation. Tau Protein/α-synuclein-IN-2 holds promise for Alzheimer's disease and Parkinson's disease research.
Tau-aggregation-IN-1 (Compound D-519) is a tau441 protein aggregation inhibitor with an IC50 of 21 µM. Tau-aggregation-IN-1 is also a dopamine D2 and D3 receptor agonist .
tau protein/α-synuclein-IN-1 is a dual inhibitor of tau protein and α-synuclein. tau protein/α-synuclein-IN-1 reduces α-syn inclusions development in M17D neuroblastoma cells. tau protein/α-synuclein-IN-1 can be used in study Alzheimer’s disease .
Tau protein aggregation-IN-1 (Compound 0c) is a Tau protein aggregation inhibitor. Tau protein aggregation-IN-1 can be used in the study of protein folding disorders such as Alzheimer's disease, dementia, Parkinson's disease, Huntington's disease and prion-based spongiform encephalopathies .
Tau-aggregation and neuroinflammation-IN-1 is a potent tau-aggregation and neuroinflammation inhibitor. Tau-aggregation and neuroinflammation-IN-1 exhibits remarkable inhibitory activities against AcPHF6 and full-length tau aggregation. Tau-aggregation and neuroinflammation-IN-1 has a low cytotoxicity and reduced NO release in LPS-stimulated BV2 cells. Tau-aggregation and neuroinflammation-IN-1 can reverse okadaic acid-induced memory impairment in rats .
Acetyl-Tau Peptide (273-284) amide is an acetylated Tau peptide fragment. Acetyl-Tau Peptide (273-284) amide limits the substantial aggregation of Ac-Aβ(25–35)-NH2 and can be used as an inhibitor of Ac-Aβ(25–35)-NH2. Acetyl-Tau Peptide (273-284) amide can be used as an experimental model to investigate the Aβ/Tau cross-interaction .
tau-0N4R-IN-1 (Compound 6T) is an BBB-penetrable inhibitor of tau 0N4R oligomerization. tau-0N4R-IN-1 effectively inhibits the fibrosis of tau 0N4R, 2N3R, and 2N4R, exhibits an anti-seeding effect on tauin vitro, reduces the oligomerization of α-syn dose-dependently, and prevents formation of α-syn inclusions. tau-0N4R-IN-1 is stable in mouse microsomes and reduces Aβ plaques in brain tissues from AD patients. tau-0N4R-IN-1 has good pharmacokinetic properties in mice .
Tau Protein Phosphorylation-IN-1 is a tau protein phosphorylation inhibitor that potently protects PC12 cells against Aβ25–35-induced cytotoxicity (EC50 = 1.93 μM), and can penetrate the blood-brain barrier (BBB).Tau Protein Phosphorylation-IN-1 reverses the hyperphosphorylation of tau, significantly inhibits the expression of certain immune-related cytotoxic factors, suppresses the MAPK and NF-κB signaling pathways, and significantly inhibits the expression of RAGE and the apoptosis factors Bax/Bcl-2, both in vitro and in vivo. Tau Protein Phosphorylation-IN-1 relieves nerve damage, and improves learning and memory in an Alzheimer’s disease (AD) mouse model. Tau Protein Phosphorylation-IN-1 can be used for AD research .
Aberrant tau ligand 2 (Compound 4-12) is the ligand for tau protein and can be used as target protein ligand for synthesis of PROTAC degrader C004019 (HY-138669) .
Tau Peptide (275-305) (Repeat 2 domain) is the Alzheimer's Tau fragment R2, corresponding to the second repeat unit of the microtubule-binding domain, which is believed to be pivotal to the biochemical properties of full tau protein. Tau Peptide (275-305) specifically coordinates with group IIB metal ions (Zn²⁺, Cd²⁺, Hg²⁺), which can induce their conformational changes and significantly promote their pathological accumulation. Tau Peptide (275-305) can be used to study the role of heavy metals in neurodegenerative diseases .
Aβ/tau aggregation-IN-3 is a potent amyloid protein aggregation inhibitor with an IC50 of 0.85 μM by Aβ-Thioflavin T (Aβ-ThT) functional aggregation assay. Aβ/tau aggregation-IN-3 has anti-amyloid activity .
PROTAC α-Synuclein/Tau degrader 1 is a blood-brain barrier-penetrant dual PROTAC degrader of α-synuclein (α-Syn) andtau, with DC50 of 1.57 μM and 4.09 μM, respectively. PROTAC α-Synuclein/Tau degrader 1 binds to α-Syn and tau PFF, with KDs of 0.47 and 2.78 μM, respectively. PROTAC α-Synuclein/Tau degrader 1 exhibits degradation effect mediated by the ubiquitin-proteasome system (UPS). PROTAC α-Synuclein/Tau degrader 6 can be used for the study of Parkinson’s disease (PD) (Pink: α-Synuclein/Tau ligand (HY-151035); Blue: CRBN ligase ligand (HY-14658); Black: Linker (HY-128803)) .
2N4R Tau/α-Syn against-1 (Compound 4d) targets α-synuclein and tau protein, inhibits the fibrillation and oligomer formation of α-synuclein and tau proteins, exhibits disaggregation activity on Aβ fibers. 2N4R Tau/α-Syn against-1 can be used in research of Parkinson's disease and Alzheimer's disease .
Microtubule-associated protein tau (26-44) is a synthetic peptide chain with an amine group attached to glutamine and an carboxyl group attached to lysine.
Tau Peptide (255-314) (Repeat 2 Domain) (human) is a polypeptide that can be found by peptide screening. Peptide screening is a research tool that pools active peptides primarily by immunoassay. Peptide screening can be used for protein interaction, functional analysis, epitope screening, especially in the field of agent research and development .
MRL828 combines a Tau pathology-binding ligand and modified guanine moiety based on the ATTEC technology to selectively designate aggregated tau proteins for clearance via the ALP. MRL828 decreases intracellular Tau aggregates and promotes the secretion of Tau .
Posdinemab (JNJ-63733657) is a humanized IgG1/κ monoclonal antibody that selectively targets phosphorylated tau (pT217). Posdinemab specifically binds to the pT217+tau epitope rich in the proline domain, blocks tau protein aggregation and seed propagation, and promotes the clearance of extracellular tau species. Posdinemab reduces the levels of free and total p217+tau in cerebrospinal fluid, thereby inhibiting the pathological propagation of tau protein and the formation of neurofibrillary tangles. Posdinemab can be used for the study of progressive supranuclear palsy syndrome and Alzheimer's disease (AD), especially for prodromal or mild AD disease .
THK-5105, an arylquinoline derivative, displays high binding affinity to tau fibrils. THK-5105 has high binding affinity to tau protein aggregates and tau-rich Alzheimer disease (AD) brain homogenates. 18F-THK-5105 has the potential to act as a tau imaging PET probe .
THK-5117, an arylquinoline derivative, displays high binding affinity to tau fibrils with a Ki of 10.5 nM. THK-5117 has high binding affinity to tau protein aggregates and tau-rich Alzheimer disease (AD) brain homogenates. 18F-THK-5117 has the potential to act as a tau imaging PET probe .
APNmAb005 is a human monoclonal antibody (mAb) targeting MAPT/Tau/PHF-tau. APNmAb005 blocks tau seeding in vitro and rescues neuronal loss in rTG4510 mice. APNmAb005 can be used in Alzheimer’s disease (AD) research .
Semorinemab (RG 6100) is an anti-Tau humanized IgG4 monoclonal antibody, targets the N-terminal portion of the Tau protein (amino acid residues 6-23). Semorinemab binds with human Tau with a Kd value of 3.8 nM. Semorinemab can be used for the research of Alzheimer's Disease .
LDN-193665 is a Tau kinase inhibitor with tauopathy-modifying activity. LDN-193665 inhibits Tau phosphorylation, improves tauopathy in animal models, reduces Sarkosyl-insoluble Tau, and restores memory. It may be necessary to simultaneously target multiple kinases to effectively inhibit tauopathies.
Hydromethylthionine dihydrobromide (Leukomethylene blue dihydrobromide) is a potent inhibitor of TAU protein aggregation. Hydromethylthionine dihydrobromide reduces neurodegeneration by interacting with TAU proteins and preventing them from forming neurotoxic aggregates. Hydromethylthionine dihydrobromide can be used in the study of Alzheimer's disease and other TAU related disorders .
DN5355 is a small molecule compound that targets amyloid β protein (Aβ) and hyperphosphorylated tau protein. DN5355 can inhibit the aggregation of Aβ and tau protein and disaggregate the formed Aβ and tau protein fibers. DN5355 can be used in the study of Alzheimer's disease .
C004019 is a BBB-penetrable and small-molecule PROTAC that targets tau. C004019 can simultaneously recruit tau and E3 ligase, and effectively clear tau proteins by promoting the ubiquitination and proteasome-dependent degradation of tau, thereby improving synaptic and cognitive functions in Alzheimer's disease (AD) mice. C004019 can be used in the research of AD and tau protein-related diseases. (Pink: Ligand for target protein (HY-138679); Black: linker (HY-140189); Blue: E3 Ligase Ligand (HY-138678))
Zagotenemab (LY3303560) is a humanised anti-tau antibody that selectively binds and neutralises tau deposits in the brain. Zagotenemab can be used in Alzheimer's disease research .
THK-523 has demonstrated its high affinity and selectivity for tau pathology both in vitro and in vivo. 18F-THK523 is a potent tau imaging radiotracer. 18F-THK523 is a potent in vivo tau imaging ligand for Alzheimer's disease .
Gosuranemab (BMS-986168; IPN007) is a humanised IgG4 anti-tau monoclonal antibody. Gosuranemab neutralizes the extracellular tau protein, inhibiting the spread and aggregation of pathological tau protein. Gosuranemab can be used for the researches of alzheimer’s disease (AD) and progressive supranuclear palsy (PSP) .
PHF6 (VQIVYK) is a self-assembly sequence capable of initiating the full-length tau protein aggregation and is mapped to the third microtubule-binding repeat region of the tau protein .
SW02 is a potent activator of ATPase activity of Hsp70, with an EC50 of 150 μM. SW02 leads to accumulation of both total tau and phosphorylated tau (pTau) .
PDDC is a compound used to inhibit Alzheimer's disease. It is a nSMase2 inhibitor that can inhibit tau-induced nSMase2 activity and ceramide elevation, and slow the spread of tau in mouse models.
Tilavonemab (ABBV-8E12) is a humanized anti-tau monoclonal antibody that binds to amino acids 25-30 near the N-terminus of the tau protein. Tilavonemab can block the ability of human and mouse neurons to uptake tau aggregates. Tilavonemab can be used for research on Alzheimer’s disease and other tauopathies .
PHF6 (VQIVYK) TFA is a self-assembly sequence capable of initiating the full-length tau protein aggregation. PHF6 TFA is mapped to the third microtubule-binding repeat region of the tau protein .
QC-01-175 is a heterobifunctional molecule, which degrades aberrant tau. QC-01-175 reduces the levels of A152T and P301L mutant tau protein and protects neurons from tau-mediated toxicity and improve cell survival (Pink: ligand for target protein Aberrant tau ligand 1 (HY-W453397); Black: linker NH2-PEG3 (HY-W007545); Blue: ligand for E3 ligase Pomalidomide (HY-10984)) .
hAChE-IN-1 (Compound 24) is a potent hAChE inhibitor with an IC50 of 1.09 μM. hAChE-IN-1 inhibits tau-oligomerization with an EC50 of 2.71 μM in cellular tau FRET assay .
AMG28 is a Tau tubulin kinase 1 (TTBK1) and TTBK2 inhibitor with IC50s of 805 nM and 988 nM, respectively. AMG28 inhibits tau phosphorylation at Ser422 (IC50 of 1.85 μM) .
CHIPOpt, a peptide, is an orthosteric CHIP TPR domain inhibitor with a Kd of ∼16 nM. CHIPOpt has anti-aggregation activity and decreases p.tau ubiquitination with little effect on unmodified tau. CHIPOpt can be used for Alzheimer’s disease research .
AADvac 1 TFA is an active tau peptide vaccine for Alzheimer's disease research. AADvac 1 TFA is composed of a regulatory peptide 294KDNIKHVPGGGS 305 that drives tau oligomerization conjugated to Aplysia hemocyanin (KLH) and formulated with aluminum hydroxide .
AEP-IN-2 is an asparagine endopeptidase (AEP) inhibitor via block AEP cleavage of APP and Tau. AEP-IN-2 has oral activity and decreases Aβ40 and Aβ42 and p-Tau levels .
Ac-Val-Gln-aIle-Val-aTyr-Lys-NH2 is a N-amino peptide that selectivity inhibits the fibrilization of tau protein. Ac-Val-Gln-aIle-Val-aTyr-Lys-NH2 is effective at blocking the cellular seeding of endogenous tau by interacting with monomeric or fibrillar forms of extracellular tau. Ac-Val-Gln-aIle-Val-aTyr-Lys-NH2 can be used for the study of neurodegenerative diseases, such as Alzheimer’s disease .
RI-AG03 is an orally active and a BBB-penetrable Tau aggregation peptide inhibitor. RI-AG03 inhibits Tau aggregation and improves associated neurodegeneration and behavioral phenotypes in both in vivo and in vitro models. RI-AG03 can be used in the study of tauopathies such as Alzheimer's disease .
Saikosaponin C is a bioactive component found in radix bupleuri, targets amyloid beta and tau in Alzheimer's disease. Saikosaponin C inhibits the secretion of both Aβ1-40 and Aβ1-42, and suppresses abnormal tau phosphorylation, but shows no effect on BACE1 activity and expression .
Florzolotau (APN1607) is a positron emission tomography (PET) ligand that can be used to detect Alzheimer's disease (AD) and other tau proteinopathies. Its binding sites are located in the β-helix of the paired helical filaments (PHFs) and straight filaments (SFs) of the tau protein, as well as in the C-shaped cavity of the SFs. In addition, APN-1607 can bind to the intraneuronal inclusions in Alzheimer's disease (AD), primary age-related tauopathy (PART), and posterior cortical atrophy (PCA). Florzolotau is expected to be used in PET imaging research of neurological diseases, especially tau proteinopathies .
BF-170 is a selective tau fibril binding agent with an EC50 of 221 nM. It exhibits good blood-brain barrier permeability, and after intravenous injection in mice, the concentration in brain tissue reaches 9.1% ID/g within 2 minutes (with a brain clearance rate of 0.25% ID/g after 30 minutes). BF-170 can be used as a probe for tau protein pathology imaging in Alzheimer's disease (AD). It plays an important role in early-stage AD research and holds potential for imaging studies of tau-related neurodegenerative diseases .
GT-02216 can bind to GCase allosterically and enhance its activity. GT-02216 enhances the activity of GCase in primary human fibroblasts. GT-02216 reduces the Tau accumulation in mutant GBA1 fibroblasts. GT-02216 protects the hippocampal primary neurons challenged with Tau oligomer in rat model .
ZJCK-6-46 (32) is a potential and orally activeDYRK1A inhibitor (IC50 = 0.68 nM) with high BBB permeability (CNS+). ZJCK-6-46 (32) reduces tau phosphorylation. ZJCK-6-46 (32) ameliorates cognitive dysfunction by obviously reducing the expression of phosphorylated tau and neuronal loss in vivo .
IONIS-MAPTRx sodium is the first Tau-lowering antisense oligonucleotide (ASO). IONIS-MAPTRx sodium has the potential for the research of Alzheimer Disease .
D-688 is an inhibitor of Tau and Aβ. D-688 can reverse Aβ1–42-induced toxicity in SH-SH5Y cells and has significant neuroprotective properties. D-688 can improve the survival rate of Drosophila melanogaster expressing the human tau protein isoform (2N4R) .
3,3'-Diethyl-9-methylthiacarbocyanine iodide is a cyanine dye, also a tau aggregation inhibitor, with an IC50 value of 0.28 μM for tau. 3,3'-Diethyl-9-methylthiacarbocyanine iodide can cause misfunction of the microtubule cytoskeleton. 3,3'-Diethyl-9-methylthiacarbocyanine iodide can be used for researching Alzheimer’s disease .
MAO-B-IN-45 is a dual inhibitor of ferroptosis and MAO-B. MAO-B-IN-45 shows selectivity towards MAO-B with an IC50 of 87.47 nM and selectivity exceeding 229-fold for MAO-B over MAO-A. MAO-B-IN-45 has excellent antiferroptosis activity through modulation of the iron metabolic pathway and GSH-GPX4 axis in vitro. MAO-B-IN-45 improves cognitive and behavioral impairments in 3×Tg (APP/Tau/Ps1) AD mouse and significantly reduced the levels of ferritin heavy chain 1 (FTH1), APP, and Tau phosphorylation (p-Tau) proteins in the brain.
IONIS-MAPTRx (BIIB080) is the first Tau-lowering antisense oligonucleotide (ASO). IONIS-MAPTRx has the potential for the research of Alzheimer Disease .
EPI-001, a selective inhibitor of Androgen Receptor (AR), targets transactivation unit 5 (Tau-5) of the AR. EPI-001 can inhibit transactivation of the AR amino-terminal domain (NTD), with an IC50 of ~6 μM. EPI-001 is also a selective modulator of PPARγ. EPI-001 is active against castration-resistant prostate cancer .
Saikosaponin C (Standard) is the analytical standard of Saikosaponin C. This product is intended for research and analytical applications. Saikosaponin C is a bioactive component found in radix bupleuri, targets amyloid beta and tau in Alzheimer's disease. Saikosaponin C inhibits the secretion of both Aβ1-40 and Aβ1-42, and suppresses abnormal tau phosphorylation, but shows no effect on BACE1 activity and expression .
RI-AG03 acetate is the acetate of RI-AG03 (HY-P10861). RI-AG03 is an orally active and a BBB-penetrable Tau aggregation peptide inhibitor. RI-AG03 inhibits Tau aggregation and improves associated neurodegeneration and behavioral phenotypes in both in vivo and in vitro models. RI-AG03 can be used in the study of tauopathies such as Alzheimer's disease .
SB1617 is a neuroinflammation-modulating agent, and has neuroprotective effect by reducing pathogenic tau levels through microglia-mediated anti-inflammatory activity .
α-Synuclein inhibitor 11 (compound 1) is a selective α-synuclein (α-syn) oligomer formation inhibitor. α-Synuclein inhibitor 11 does not inhibits tau 4R (isoforms 0N4R, 2N4R) or p-tau (isoform 1N4R). α-Synuclein inhibitor 11 can be used for Parkinson's disease (PD) research .
PhosTAC7 is a heterobifunctional molecule named as a Phosphorylation Targeting Chimera (PhosTAC). PhosTAC7 can dephosphorylate the PDCD4 protein, FOXO3a protein, and tau protein by recruiting serine/threonine protein phosphatase 2A (PP2A). PhosTAC7 offers the advantage of selectively modulating the phosphorylation state of individual target proteins, making it a promising tool for research in cancer and tau protein-related neurodegenerative diseases (Alzheimer's disease) .
T807 (Standard) is the analytical standard of T807. This product is intended for research and analytical applications. T807 a novel tau positron emission tomography (PET) tracer.
TBL-100 is a human monoclonal antibody (mAb) targeting Tau. TBL-100 can be used in Alzheimer's disease (AD) and Progressive supranuclear palsy research .
N-Boc-trans-4-fluoro-L-proline is a non-natural amino acid substitute used to construct monoclonal antibodies that specifically target the seed conformation of tau protein .
REM127 is a small molecule compound capable of modulating calcium homeostasis in cells and possesses neuroprotective effects. REM127 can restore the calcium homeostasis imbalance in cellular models caused by pathological accumulation of tau protein. REM127 can efficiently cross the blood-brain barrier, and it has the potential to rescue synaptic and cognitive deficits in Alzheimer's disease animal models, as well as to slow down the progression of amyloid-beta and tau protein pathologies. REM127 can be used for research in neurodegenerative diseases .
HDAC6-IN-37 (compound W5) is an inhibitor of HDAC6 and has neuroprotective effects. HDAC6-IN-37 can restore the morphology of hippocampal neurons, reduce the expression of Aβ, Tau, and p-Tau proteins in the hippocampus of AD rats, and inhibit the formation of senile plaques and neurofibrillary tangles. Thus, HDAC6-IN-37 improves the Aβ/Cu 2+-induced AD model in rats, regulates oxidative stress status, and balances neurotransmitter disorders in brain tissue .
EPI-001 (Standard) is the analytical standard of EPI-001. This product is intended for research and analytical applications. EPI-001, a selective inhibitor of Androgen Receptor (AR), targets transactivation unit 5 (Tau-5) of the AR. EPI-001 can inhibit transactivation of the AR amino-terminal domain (NTD), with an IC50 of ~6 μM. EPI-001 is also a selective modulator of PPARγ. EPI-001 is active against castration-resistant prostate cancer .
OX-201 is a selective agonist for OX2R with an EC50 of 8 nM. Pathological proteins produced by neurons are released into the interstitial fluid (ISF) in a manner dependent on neuronal activity and are cleared from the brain via lymphatic pathways. The outflow of pathological proteins to the ISF is related to the arousal state of neurons. OX-201 can induce neuronal awakening and promote the release of tau into the hippocampal ISF. Although OX-201 does not alter hippocampal tau levels, it has potential applications for Alzheimer's disease (AD) associated with sleep/wake rhythm disturbances .
MG-1102 is first-in-class dual binder of monomeric tau and pre-miRNA-146a. MG-1102 shows specific inhibition of miRNA146a with IC50s of 0.21 mM and 0.36 mM specific inhibition of doublelabeled pre-miRNA146a and mono-labeled pre-miRNA146a, respectively. MG-1102 interacts with tau monomers with a Kd of 3.21 mM by surface plasmon resonance (SPR). MG-1102 is a potential multi-target-directed ligands (MTDLs) for Alzheimer’s disease (AD) .
CNS-11 is a blood-brain barrier permeable tau fibril-degrading compound. CNS-11 reduces α-synuclein. CNS-11 can be used in Alzheimer's and Parkinson's disease research .
Bepranemab (UCB 0107) is a humanized, full-length IgG4 monoclonal antibody. Bepranemab targets the central portion of tau, specifically amino acids 235 to 246. Bepranemab can be used for Alzheimer’s disease (AD) research .
hAChE-IN-2 is a potent hAChE inhibitor, with an IC50 of 0.71 μM. hAChE-IN-2 can also inhibits tau-oligomerization, with an EC50 of 2.21 μM. hAChE-IN-2 exhibits neuroprotective activity .
BSB is a Congo red-derived fluorescent probe. BSB binds not only to extracellular amyloid β protein, but also many intracellular lesions composed of abnormal tau and synuclein proteins. BSB acts as a prototype imaging agent for Alzheimer's disease .
JG-23 is a 4-chloro modified analog with ability to promote t-tau degradation. JG-23 exhibits good metabolic stability with a long T1/2 value (36 min) in mouse liver microsome assays .
NQTrp, an aromatic naphthoquinone-tryptophan hybrid molecule, an inhibitor of the aggregation of the tau protein with generic anti-amyloidogenic effects. NQTrp inhibits the in vitro aggregation of hexapeptide ( 41GCWMLY 46 within the N-terminus of γD-crystallin) as well as full-length γD-crystallin .
δ-Secretase inhibitor 11 (compound 11) is an orally active, potent, BBB-penetrated, non-toxic, selective and specific δ-secretase inhibitor, with an IC50 of 0.7 μM. δ-Secretase inhibitor 11 interacts with both the active site and allosteric site of δ-secretase. δ-Secretase inhibitor 11 attenuates tau and APP (amyloid precursor protein) cleavage. δ-Secretase inhibitor 11 ameliorates synaptic dysfunction and cognitive impairments in tau P301S and 5XFAD transgenic mouse models. δ-Secretase inhibitor 11 can be used for Alzheimer's disease research .
IU1-47 is a potent and specific USP14 inhibitor with an IC50 of 0.6 μM. IU1-47 inhibits IsoT/USP5 with an IC50 of 20 μM. IU1-47 induces tau elimination in cultured neurons .
T808 is a tau-selective Alzheimer’s PET ligand. T808 is a type of imaging agent used in positron emission tomography (PET) scans. It is a radiotracer that is used to help visualize certain areas of the body, such as the brain, in order to diagnose and monitor various medical conditions .
Quercetagitrin (Quercetagetin-7-O-glucoside) is a natural product that can be isolated from the African marigold (Tagetes erecta). Quercetagitrin has anti-inflammatory activity. Quercetagitrin inhibits Tau accumulation. Quercetagitrin can reverse neuroinflammation and cognitive deficits in P301S-Tau transgenic mouse model through inhibiting NF-κB activation. Quercetagitrin is a dual-target inhibitor of PTPN6 (IC50 = 1 μM) and PTPN9 (IC50 = 1.7 μM). Quercetagitrin enhances glucose uptake by mature C2C12 myoblasts. Quercetagitrin can be studied in research for Alzheimer’s disease and type 2 diabetes .
Leucomethylene blue (TRx0237) mesylate, an orally active second-generation tau protein aggregation inhibitor (Ki of 0.12 μM), could be used for the study of Alzheimer's Disease. Leucomethylene blue mesylate is a common reduced form of Methylene Blue, Methylene Blue is a member of the thiazine class of dyes .
IDT is a safe and effective TNFα and innate immune system modulator. IDT significantly reduced paired helical filament tau and fibrillar amyloid accumulation and increased the infiltrating neutrophil population while reducing TNFα expression in this population. IDT can be used in Alzheimer's disease research .
BChE-IN-39 (Compound 7c) is a selective inhibitor for butyrylcholinesterase (BChE) with an IC50 of 0.08 μM (IC50=3.98 μM for AChE). BChE-IN-39 downregulates the GSK-3β expression, inhibits the hyperphosphorylation of tau protein .
MAO-B-IN-31 (Compound 30) is an effective and selective inhibitor of monoamine oxidase B (monoamine oxidase B). The IC50 value is 41 nM. MAO-B-IN-31 also inhibits α-syn and tau aggregation. MAO-B-IN-31 has neuroprotective activity .
Quercetagitrin (Standard) is the analytical standard of Quercetagitrin. This product is intended for research and analytical applications. Quercetagitrin (Quercetagetin-7-O-glucoside) is a natural product that can be isolated from the African marigold (Tagetes erecta). Quercetagitrin has anti-inflammatory activity. Quercetagitrin inhibits Tau accumulation. Quercetagitrin can reverse neuroinflammation and cognitive deficits in P301S-Tau transgenic mouse model through inhibiting NF-κB activation. Quercetagitrin is a dual-target inhibitor of PTPN6 (IC50 = 1 μM) and PTPN9 (IC50 = 1.7 μM). Quercetagitrin enhances glucose uptake by mature C2C12 myoblasts. Quercetagitrin can be studied in research for Alzheimer’s disease and type 2 diabetes .
GSK-3β inhibitor 24 (Compound 41) is a potent GSK-3β inhibitor with an IC50 of 0.22 nM. GSK-3β inhibitor 24 increases GSK-3β phosphorylation at Ser9 site dose-dependently. GSK-3β inhibitor 24 inhibits the hyperphosphorylation of tau protein by decreasing the p-tau-Ser396 abundance. GSK-3β inhibitor 24 up-regulates β-catenin and neurogenesis-related markers (GAP43 and MAP-2). GSK-3β inhibitor 24 demonstrates remarkable anti-Alzheimer's disease (AD) effects .
PNT001 is a human IgG1 monoclonal antibody (mAb) targeting cis-pT231 Tau. PNT001 can be used in Neurodegenerative disorders and Traumatic brain injuries research. Recommended isotype control: Human IgG1 kappa, Isotype Control (HY-P99001) .
PTC-700 is a potent microtubule-associated protein tau (MAPT) splicing modulator. PTC-700 reduces 4R MAPT in both P301L and S305N neurons with EC50s of 1.3-1.8 nM, and 0.5-2.6 nM, respectively .
CDK18 is a neuronal kinase that phosphorylates TAU protein when overexpressed in human brain. CDK18 shares a conserved PCTAIRE amino acid sequence in the helical α-C region of the kinase N-lobe. CDK18/CycY Recombinant Human Active Protein Kinase is an ortholog of CDK18 .
Dyrk1A-IN-11 (compound 166) is a potent dual-specificity tyrosine phosphorylation- regulated 1A (DYRK1A) inhibitor with an EC50 value of 0.0021 µM. Dyrk1A-IN-11 inhibits the Phospho-Tau (Thr212) with an EC50 value of 0.0361 µM .
Cu(II)GTSM, a cell-permeable Cu-complex, significantly inhibits GSK3β. Cu(II)GTSM inhibits Amyloid-β oligomers (AβOs) and decreases tau phosphorylation. Cu(II)GTSM also decreases the abundance of Amyloid-β trimers. Cu(II)GTSM is a potential anticancer and antimicrobial agent .
TTBK1/2-IN-2 (compound 9) is a potent Tau tubulin kinase 1 (TTBK1) and TTBK2 inhibitor with IC50s of 384 nM and 175 nM, respectively. TTBK1/2-IN-2 shows a significant ciliogenesis phenotype in human induced pluripotent stem cells (iPSCs) .
Dyrk1A-IN-9 (Compound L9) is a moderately active DYRK1A inhibitor (IC50: 1.67 μM). L9 shows neuroprotective activity by regulating the expression of Aβ and phosphorylation of Tau protein. Dyrk1A-IN-9 can be used for research of Alzheimer's disease .
GSK-3β inhibitor 21 (compound 44) is an ATP-competitive GSK-3β inhibitor (IC50=6.06 μM) with anti-amyloid aggregation and tau phosphorylation inhibitory activities. GSK-3β inhibitor 21 can be used in the study of Alzheimer's disease .
TTBK1/2-IN-3 (compound 10) is a potent Tau tubulin kinase 1 (TTBK1) and TTBK2 inhibitor with IC50s of 579 nM and 258 nM, respectively. TTBK1/2-IN-3 reduces the expression of primary cilia on the surface of human induced pluripotent stem cells (iPSCs) .
RA-PR058 is an orally active Ramalin derivative with blood-brain barrier permeability, exhibiting multi-target regulatory effects and favorable pharmacokinetic properties. RA-PR058 demonstrates potential as a multi-target modulator for Alzheimer's disease by reducing the expression of BACE1, tau protein hyperphosphorylation, and anxiety-like behaviors .
GSK-3β inhibitor 16 (compound 7c) is a GSK-3β inhibitor with the IC50 of 4.68 nM. GSK-3β inhibitor 16 decreases Tau hyperphosphorylated aggregate and alleviates cognitive impairments in the Scopolamin (HY-N0296)-induced model in mice .
Sabeluzole (R 58735), a benzothiazol derivative, has antiischemic, antiepileptic, and cognitive-enhancing properties. Sabeluzole protects rat hippocampal neurons against NMDA- and glutamate-induced neurotoxicity via preventing tau expression. Sabeluzole enhances memory in rats, and prevents the amnesic effect of Chlordiazepoxide. Sabeluzole can be used fro research of Alzheimer's disease .
AChE-IN-10 (Compound 24r) is a potent inhibitor of AChE (IC50 = 2.4 nM). AChE-IN-10 potently inhibits AChE, reduces tau phosphorylation at S396 residue, provides neuroprotection by rescuing neuronal morphology and increasing cell viability. AChE-IN-10 is also found to reduce amyloid aggregation in the presence of AChE .
4-Hydroxyisophthalic acid activates antioxidant enzymes (such as catalase CAT and superoxide dismutase SOD), scavenges free radicals, and exhibits antioxidant property. 4-Hydroxyisophthalic acid activates AChE and BChE, enhances neuronal function and improves Tau-induced neurobehavioral defects. 4-Hydroxyisophthalic acid improves the cognitive defects, and ameliorates circadian rhythm disorders of fruit flies .
Simufilam hydrochloride (PTI-125 hydrochloride) is an orally active FLNA modulator. Simufilam hydrochloride restores NMDAR signaling and Arc expression. Simufilam hydrochloride inhibits overactive mTOR signaling by restoring the normal conformation of FLNA, improves insulin sensitivity, reduces Aβ42-induced neuroinflammation and tau protein hyperphosphorylation. Simufilam hydrochloride can be used for research of Alzheimer's disease .
Simufilam (PTI-125) is an orally active FLNA modulator. Simufilam restores NMDAR signaling and Arc expression. Simufilam inhibits overactive mTOR signaling by restoring the normal conformation of FLNA, improves insulin sensitivity, reduces Aβ42-induced neuroinflammation and tau protein hyperphosphorylation.
Simufilam can be used for research of Alzheimer's disease .
Simufilam dihydrochloride (PTI-125 dihydrochloride) is an orally active FLNA modulator. Simufilam dihydrochloride restores NMDAR signaling and Arc expression. Simufilam dihydrochloride inhibits overactive mTOR signaling by restoring the normal conformation of FLNA, improves insulin sensitivity, reduces Aβ42-induced neuroinflammation and tau protein hyperphosphorylation. Simufilam dihydrochloride can be used for research of Alzheimer's disease .
Nav1.1 activator 1 (compound 4), a highly potent Nav1.1 activator with BBB penetration, increases decay time constant τ of Nav1.1 currents at 0.03 μM along with significant selectivity against Nav1.2, Nav1.5, and Nav1.6 .
hBChE-IN-1 (compound 4), a quinolizidinyl derivative, is a potent hBChE inhibitor (IC50=7 nM) and highly selective over hAChE. hBChE-IN-1 shows inhibitory activity against tau and Aβ40 protein aggregation, with IC50 values of 20 and 4.3 μM, respectively. hBChE-IN-1 can be used for Alzheimer's disease research .
BuChE-IN-5 (compound 25b) is a potent BuChE inhibitor with an IC50 value of 1.94 μM. BuChE-IN-5 efficiently inhibits aggregation Aβ and tau protein in Escherichia coli. BuChE-IN-5 also has free radical scavenging capacity and antioxidant activity. BuChE-IN-5 can be used for researching Alzheimer’s disease .
SZM679 is a potent, orally active and selective RIPK1 inhibitor with Kd values of 8.6 nM and >5000 nM for RIPK1 and RIPK3, respectively. SZM679 reverses the tumor necrosis factor-induced systemic inflammatory response. SZM679 decreases the Tau hyperphosphorylation, neuroinflammation, and the RIPK1 phosphorylation level in the hippocampus and cortex. SZM679 can be used in research of Alzheimer's disease (AD) .
GSK3β-IN-3 is an ATP-competitive GSK-3β inhibitor (IC50 = 0.90 μM). GSK3β-IN-3 can reduce the phosphorylation level of tau protein in the BR5706 strain and reduce the deposition of Aβ aggregates in the CL2006 strain, and can be used to research Alzheimer's disease (AD) .
(R,S,S)-VH032 is Ligand for E3 Ligase used in the synthesis of PROTACs. VH032 is a VHL ligand and VHL/HIF-1α interaction inhibitor that recruits von Hippel-Lindau (VHL) proteins. (R,S,S)-VH032 synthesizes the tau-targeting small molecule PROTAC C004019 (HY-138669) .
hAChE-IN-6 (compound 51) is a brain penetrant AChE inhibitor with an IC50 of 0.16 μM. hAChE-IN-6 also inhibits hBuChE and GSK3β with IC50 values of 0.69 μM and 0.26 μM, respectively. hAChE-IN-6 inhibits tau protein and Aβ1-42 self-aggregation, and can be used for Alzheimer's disease (AD) research .
Surfen is a potent heparan sulfate antagonist. Surfen inhibits FGF2 binding and signal transduction. Surfen binds to glycosaminoglycans and reduces tau hyperphosphorylation. Surfen inhibits the activity of recombinant uronyl 2-O-sulfotransferase with an IC50 of approximately 2 μM. Surfen inhibits HSV-1 viral infection. Surfen inhibits neural differentiation, delays remyelination, and alleviates EAE .
Sabeluzole (Standard) is the analytical standard of Sabeluzole. This product is intended for research and analytical applications. Sabeluzole (R 58735), a benzothiazol derivative, has antiischemic, antiepileptic, and cognitive-enhancing properties. Sabeluzole protects rat hippocampal neurons against NMDA- and glutamate-induced neurotoxicity via preventing tau expression. Sabeluzole enhances memory in rats, and prevents the amnesic effect of Chlordiazepoxide. Sabeluzole can be used fro research of Alzheimer's disease .
Surfen dihydrochloride is a potent heparan sulfate antagonist. Surfen inhibits FGF2 binding and signal transduction. Surfen binds to glycosaminoglycans and reduces tau hyperphosphorylation. Surfen dihydrochloride inhibits the activity of recombinant uronyl 2-O-sulfotransferase with an IC50 of approximately 2 μM. Surfen dihydrochloride inhibits HSV-1 viral infection. Surfen dihydrochloride inhibits neural differentiation, delays remyelination, and alleviates EAE .
TTBK1-IN-2 (compound 29) is a potent Tau-Tubulin kinase (TTBK1) inhibitor with IC50s of 0.24 and 4.22 µM, respectively. TTBK1-IN-2 reveals good brain penetration in vivo and is able to reduce TDP-43 phosphorylation not only in cell cultures but also in the spinal cord of transgenic TDP-43 mice .
SCR1693 is a selective, reversible, orally active and noncompetitive inhibitor of AChE (IC50 = 0.68 μM) as well as a calcium channel blocker. SCR1693 reduces tau phosphorylation levels, and inhibits the generation and release of Aβ. SCR1693 restores insulin signaling and improves cognitive deficits. SCR1693 can be used for the study of Alzheimer's disease, especially which complicated with type 2 diabetes mellitus .
Nimbin is an orally active intermediate limonoid found in Azadirachta. Nimbin prevents tau aggregation and increases cell viability. Nimbin is effective inhibits the envelope protein of dengue virus. Nimbin has anti-inflammatory, antipyretic, antifungal, antihistamine, antiseptic, antioxidant, anti-cancer and anti-viral properties. Nimbin can across blood-brain barrier. Nimbin is promising for research of neurodegenerative diseases and viral infections .
Aha1/Hsp90-IN-1 (Compound 17) is an Aha1/Hsp90 complex inhibitor. Aha1/Hsp90-IN-1 disrupts Aha1/Hsp90 interactions with an IC50 of 3.32 μM. Aha1/Hsp90-IN-1 inhibits tau aggregation .
PD 118717 is a selective dopamine (DA) D-2 autoreceptor agonist. PD 118717 has significant affinity for 5-HT1A but not 5-HT1B and 5-HT2 receptors. PD 118717 is active in antagonizing the tau-Butyrolactone-induced accumulation of dopa in rat striatum and mesolimbic regions. PD 118717 exhibits an antipsychotic-like profile .
(-)Clausenamide is an active alkaloid isolated from the leaves of Clausena lansium (Lour.) Skeels, and improves cognitive function in both normal physiological and pathological conditions. (-)Clausenamide inhibits β-amyloid (Aβ) toxicity, blocking neurofibrillary tangle formation by inhibiting the phosphorylation of tau protein. (-)Clausenamide exerts a significant neuroprotective activity against Aβ25-35. (-)Clausenamide can be used for researching Alzheimer's disease (AD) .
Egalognastat (ASN90) is a selective, brain-penetrant and orally active O-GlcNAcase (OGA) enzyme inhibitor with an IC50 value of 10.2 nM. Egalognastat increases O-GlcNAcylation of intracellular proteins like tau and α-synuclein, preventing their aggregation and toxicity. Egalognastat does not inhibit hexosaminidase (Hex). Egalognastat can be used for the research of neurodegenerative diseases, such as tauopathies and α-synucleinopathies (e.g., Alzheimer’s disease and Parkinson’s disease) .
TTBK1-IN-1 is a potent, selective and brain-penetrant tau tubulin kinase 1 (TTBK1) inhibitor with an IC50 of 2.7 nM. TTBK1-IN-1 can be used for the research of alzheimer’s disease and related tauopathies . TTBK1-IN-1 is a click chemistry reagent, it contains an Alkyne group and can undergo copper-catalyzed azide-alkyne cycloaddition (CuAAc) with molecules containing Azide groups.
Apostatin-1 (Apt-1) is a potent TRADD inhibitor. Apostatin-1 can bind with TRADD-N (KD=2.17 μM), disrupting its binding to both TRADD-C and TRAF2. Apostatin-1 modulates the ubiquitination of RIPK1 and beclin 1. Apostatin-1 blocks apoptosis and restores cellular homeostasis by activating autophagy in cells with accumulated mutant tau, α-synuclein, or huntingtin .
Annonacin is an acetylgenin that is toxic by inhibiting the pathway of the mitochondrial complex. Annonacin increases tau phosphorylation in R406W +/+ mice. Annonacin acts as an inhibitor of the sodium/potassium and sarcoplasmic reticulum (SERCA) ATPase pumps. Annonacin has significant killing effect on ovarian cancer cell, cervical cancer cell, breast cancer cell, bladder cancer cell and skin cancer cell. Annonacin induces apoptosis through Bax and Caspase-3-related pathways .
GSK-3β inhibitor 27 (Compound 1c) is a reversible and competitive GSK-3β inhibitor with an IC50 value of 2.2 μM. GSK-3β inhibitor 27 inhibits tau hyperphosphorylation, reduces Aβ protein aggregation and possesses metal chelation and neuroprotective potential. GSK-3β inhibitor 27 is promising for research of neurodegenerative diseases (such as Alzheimer’s disease) .
PD146176 (Standard) is the analytical standard of PD146176. This product is intended for research and analytical applications. PD146176 (NSC168807), a 15-Lipoxygenase (15-LO) inhibitor, inhibits rabbit reticulocyte 15-LO (Ki=197 nM, IC50=0.54 μM). PD146176 reverses cognitive impairment, brain amyloidosis, and tau pathology by stimulating autophagy in aged triple transgenic mice .
BRD1172 (ML320) is a selectivity GSK3β inhibitor with an IC50 of 24 nM for GSK3β over CDK5. BRD1172 significantly inhibits GSK3β-mediated Tau phosphorylation in SH-SY5Y cells, and relieves negative regulation by GSK3β on β-catenin degradation and TCF/LEF promoter activities. BRD1172 can be used for Alzheimer’s disease, cardiac hypertrophy and cancers research .
hAChE/hBuChE/GSK-3β-IN-1 (Compound 6c) is a BBB-penetrable and multi-target anti-Alzheimer's disease compound. hAChE/hBuChE/GSK-3β-IN-1 is the inhibitors of hAChE (IC50: 28.88 nM), hBuChE (IC50: 131.90 nM) and GSK-3β (IC50: 51.42 nM). hAChE/hBuChE/GSK-3β-IN-1 is the tau and Aβ protein aggregation inhibitors .
GSK-3 inhibitor 4 is an orally active and brain-penetrant inhibitor of GSK-3, CDK2, and CDK5, with IC50 values of 0.56 nM (GSK-3β), 0.45 nM (GSK-3α), 0.47 μM, and 0.68 μM, respectively. GSK-3 inhibitor 4 effectively reduces the phosphorylation level of Tau protein. GSK-3 inhibitor 4 can be used in Alzheimer's disease (AD) studies .
KU-177 is a potent inhibitor of Hsp90 ATPase homologue 1 (Aha1), ablates Aha1-driven enhancement of Hsp90-dependent tau aggregation. KU-177 also disrupts Aha1/Hsp90 interactions (IC50=4.08 μM) without inhibition of Hsp90’s ATPase activity. KU-177 can be used for tauopathies research .
FO-4-15 is an mGluR1/CaMKIIα activator. FO-4-15 has a protective effect against H2O2 in human neuroblastoma (SH-SY5Y) cells. FO-4-15 can improve cognitive impairment in Alzheimer’s disease mice by activating the mGluR1/CaMKIIα pathway, and can reduce Aβ accumulation, hyperphosphorylated Tau, and synaptic damage .
Omigapil maleate, an orally bioavailable GAPDH nitrosylation inhibitor, abrogates Aβ1-42-induced tau acetylation, memory impairment, and locomotor dysfunction in mice. Omigapil maleate has the potential for the research of Alzheimer's disease . Omigapil maleate (CGP3446B maleate) is a apoptosis inhibitor. Omigapil maleate can be used for the research of congenital muscular dystrophy (CMD) . Omigapil (maleate) is a click chemistry reagent, it contains an Alkyne group and can undergo copper-catalyzed azide-alkyne cycloaddition (CuAAc) with molecules containing Azide groups.
AChE/BChE-IN-29 is an AChE/BChE inhibitor. AChE/BChE-IN-29 exhibits balanced dual cholinesterase inhibitory activity with IC50 values of 2.1 μM for Electrophorus electricus AChE (eeAChE) and 6.3 μM for equine serum butyrylcholinesterase (eqBChE). AChE/BChE-IN-29 effectively inhibits amyloid-β (Aβ42) aggregation and tau protein aggregation in E. coli cell models. AChE/BChE-IN-29 can be used for the study of Alzheimer’s disease (AD) .
Methylene blue (Basic Blue 9) hydrate is a guanylyl cyclase (sGC), monoamine oxidase A (MAO-A) and NO synthase (NOS) inhibitor. Methylene blue is a vasopressor and is often used as a dye in several medical procedures. Methylene blue hydrate through the nitric oxide syntase/guanylate cyclase signalling pathway to reduce prepulse inhibition. Methylene blue hydrate is a REDOX cycling compound and able to cross the blood-brain barrier. Methylene blue hydrate is a Tau aggregation inhibitor. Methylene blue hydrate reduces cerebral edema, attenuated microglial activation and reduced neuroinflammation .
GSK-3 inhibitor 3 is a selective, orally active and brain-penetrant inhibitor of GSK-3, with IC50s of 0.35 nM and 0.25 nM for GSK-3α and GSK-3β, respectively. GSK-3 inhibitor 3 lowers levels of tau protein phosphorylation at S396 in a triple-transgenic mouse Alzheimer’s disease model, with IC50 of 10 nM. GSK-3 inhibitor 3 can be used for neurological disease research .
MPT0G211 mesylate is a potent, orally active and selective HDAC6 inhibitor (IC50=0.291 nM). MPT0G211 mesylate displays >1000-fold selective for HDAC6 over other HDAC isoforms. MPT0G211 mesylate can penetrate the blood-brain barrier. MPT0G211 mesylate ameliorates tau phosphorylation and cognitive deficits in an Alzheimer’s disease model. MPT0G211 mesylate has anti-metastatic and neuroprotective effects. Anticancer activities .
BChE/HDAC6-IN-2 (compound 29a) is a dual inhibitor of BChE and HDAC6 with IC50s of 1.8 nM and 71.0 nM, respectively. BChE/HDAC6-IN-2 has prominently neuroprotective effects and reactive oxygen species (ROS) scavenging activity. BChE/HDAC6-IN-2 is also an effective chelator of metal ion (Fe 2+ and Cu 2+). BChE/HDAC6-IN-2 inhibits phosphorylation of tau, and exhibits moderate immunomodulatory effect.
MPT0G211 is a potent, orally active and selective HDAC6 inhibitor (IC50=0.291 nM). MPT0G211 displays >1000-fold selective for HDAC6 over other HDAC isoforms. MPT0G211 can penetrate the blood-brain barrier. MPT0G211 ameliorates tau phosphorylation and cognitive deficits in an Alzheimer’s disease model. MPT0G211 has anti-metastatic and neuroprotective effects. Anticancer activities .
Anti-Mouse/Human PrP/prion protein Antibody (TW1) is a mouse-derived IgG2a type antibody inhibitor, targeting to mouse/human PrP/prion protein. Anti-Mouse/Human PrP/prion protein Antibody (TW1) binds to both PrPc (cellular prion protein) and PrPSc (Scrapie Prion Protein) and blocks the interaction of prion protein with tau protein. Anti-Mouse/Human PrP/prion protein Antibody (TW1) can be used for the researches of Alzheimer’s disease (AD) .
JNK3 inhibitor-9 (Compound 24a) is a potent, selective and BBB-permeable JNK3 inhibitor with an IC50 value of 12 nM. JNK3 inhibitor-9 also potently inhibits GSK3α/β (IC50s: 14 and 35 nM, respectively) involved in Tau phosphorylation. JNK3 inhibitor-9 reduces c-Jun and APP phosphorylation. JNK3 inhibitor-9 protects neurons from Aβ1-42 toxicity .
VEN-02XX is an orally active and brain-permeable NLRP3 inhibitor. VEN-02XX inhibits the release of IL-1β and IL-18 (IC50 0.3 and 0.28 μM, respectively). VEN-02XX restores memory and cognition, inhibits microgliosis, and reduces neuroinflammation and tau pathology in the 5XFAD/Rubicon KO mouse model. VEN-02XX may be used in the study of Alzheimer's disease (AD) .
GSK3β-IN-2 (Compound S01) is the inhibitor for GSK3β with an IC50 of 0.35 nM. GSK3β-IN-2 activates Wnt/β-catenin signaling pathway, promotes neurogenesis and neurite growth. GSK3β-IN-2 inhibits Aβ-induced tau hyperphosphorylation at Ser396, reduces the formation of neurofibrillary tangles. GSK3β-IN-2 ameliorates Alzheimer's Disease in zebrafish model .
Methylene blue (Basic Blue 9) is a guanylyl cyclase (sGC), monoamine oxidase A (MAO-A) and NO synthase (NOS) inhibitor. Methylene blue is a vasopressor and is often used as a dye in several medical procedures. Methylene blue through the nitric oxide syntase/guanylate cyclase signalling pathway to reduce prepulse inhibition. Methylene blue is a REDOX cycling compound and able to cross the blood-brain barrier. Methylene blue is a Tau aggregation inhibitor. Methylene Blue is a photosensitizer and redox agent. Methylene blue reduces cerebral edema, attenuated microglial activation and reduced neuroinflammation .
7BIO (7-Bromoindirubin-3-Oxime) is the derivate of indirubin. 7BIO (7-Bromoindirubin-3-Oxime) has inhibitory effects against cyclin-dependent kinase-5 (CDK5) and glycogen synthase kinase-3β (GSK3β). 7BIO (7-Bromoindirubin-3-Oxime) inhibits Aβ oligomer-induced neuroinflammation, synaptic impairments, tau hyper-phosphorylation, activation of astrocytes and microglia, and attenuates Aβ oligomer-induced cognitive impairments in mice [1].
(R)-TTBK1-IN-1 is a potent, selective and brain-penetrant tau tubulin kinase 1 (TTBK1) inhibitor. (R)-TTBK1-IN-1 is an enantiomer of TTBK1-IN-1 (HY-134968). (R)-TTBK1-IN-1 can be used in the research of alzheimer’s disease and related tauopathies . (R)-TTBK1-IN-1 is a click chemistry reagent, it contains an Alkyne group and can undergo copper-catalyzed azide-alkyne cycloaddition (CuAAc) with molecules containing Azide groups.
Rolofylline (KW-3902) is a potent, selective adenosine A1 receptor antagonist that is under development for the treatment of patients with acute congestive heart failure and renal impairment.
Rolofylline is metabolized primarily to the pharmacologically active M1-trans and M1-cis metabolites by cytochrome P450 (CYP450) .
Rolofylline is alleviating the presynaptic dysfunction and restores neuronal activity as well as dendritic spine levels in vitro, is an interesting candidate to combat the hypometabolism and neuronal dysfunction associated with Tau-induced neurodegenerative diseases .
BRI-50460 is an inhibitor of cytosolic calcium-dependent phospholipase A2 (cPLA2) that has the ability to penetrate the blood-brain barrier, with an IC50 of 0.88 nM. BRI-50460 exerts the activities of regulating neuroinflammation and restoring lipid homeostasis by inhibiting cPLA2, regulating the downstream inflammatory lipid signaling pathway, and alleviating the effects of amyloid β42 oligomers on the activation of cPLA2, the hyperphosphorylation of tau protein, and the reduction of synapses and dendrites. BRI-50460 can be applied to the research in the fields of Alzheimer's disease and other neurodegenerative diseases .
GSK-3β inhibitor 13 (compound 47) is an orally active and potent GSK-3β inhibitor with blood-brain permeability. GSK-3β inhibitor 13 inhibits GSK-3β and GSK-3α with IC50s of 0.73 nM and 0.35 nM, respectively. GSK-3β inhibitor 13 significantly decreases the phosphorylation of tau (IC50=58 nM), which leads the formation of the neurofibrillary tangles associated with Alzheimer's disease .
Okadaic acid, a marine toxin, is an inhibitor of protein phosphatases (PP). Okadaic acid has a significantly higher affinity for PP2A (IC50=0.1-0.3 nM), and inhibits PP1 (IC50=15-50 nM), PP3 (IC50=3.7-4 nM), PP4 (IC50=0.1 nM), PP5 (IC50=3.5 nM), but does not inhibit PP2C. Okadaic acid increases of phosphorylation of a number of proteins by inhibiting PP, and acts a tumor promoter. Okadaic acid induces tau phosphorylation .
O-GlcNAcase-IN-2 (compound 81) is an orally effective, blood-brain barrier-permeable OGA inhibitor (IC50=4.93 nM). O-GlcNAcase-IN-2 can increase the O-GlcNAcylation level of proteins and phosphorylation of tau (p-Ser199, p-Thr205 and p-Ser396) in the OA-damaged SH-SY5Y cell model. O-GlcNAcase-IN-2 can also improve cognitive impairment in APP/PS1 mice and has potential anti-Alzheimer's disease (AD) effects .
Okadaic acid sodium, a marine toxin, is an inhibitor of protein phosphatases (PP). Okadaic acid (sodium) has a significantly higher affinity for PP2A (IC50=0.1-0.3 nM), and inhibits PP1 (IC50=15-50 nM), PP3 (IC50=3.7-4 nM), PP4 (IC50=0.1 nM), PP5 (IC50=3.5 nM), but does not inhibit PP2C. Okadaic acid sodium increases of phosphorylation of a number of proteins by inhibiting PP, and acts a tumor promoter. Okadaic acid sodium induces tau phosphorylation .
Punicic acid is a bioactive compound of pomegranate seed oil. Punicic acid is an isomer of conjugated α-linolenic acid and ω-5 polyunsaturated fatty acids. Punicic acid has anti-inflammatory and antioxidant activities and can inhibit the expression of inflammatory mediators such as tumor necrosis factor α (TNF-α). Punicic acid can also reduce the formation of β-amyloid deposits and hyperphosphorylation of tau by increasing the expression of GLUT4 protein and inhibiting the overactivation of calpain, and is used to prevent and treat neurodegenerative diseases. In addition, punicic acid also has breast cancer inhibitor properties that depend on lipid peroxidation and PKC pathways .
Methylene Blue (Standard) is the analytical standard of Methylene Blue. This product is intended for research and analytical applications. Methylene blue (Basic Blue 9) is a guanylyl cyclase (sGC), monoamine oxidase A (MAO-A) and NO synthase (NOS) inhibitor. Methylene blue is a vasopressor and is often used as a dye in several medical procedures. Methylene blue through the nitric oxide syntase/guanylate cyclase signalling pathway to reduce prepulse inhibition. Methylene blue is a REDOX cycling compound and able to cross the blood-brain barrier. Methylene blue is a Tau aggregation inhibitor. Methylene blue reduces cerebral edema, attenuated microglial activation and reduced neuroinflammation .
Okadaic acid ammonium salt, a marine toxin, is an inhibitor of protein phosphatases (PP). Okadaic acid ammonium salt has a significantly higher affinity for PP2A (IC50=0.1-0.3 nM), and inhibits PP1 (IC50=15-50 nM), PP3 (IC50=3.7-4 nM), PP4 (IC50=0.1 nM), PP5 (IC50=3.5 nM), but does not inhibit PP2C. Okadaic acid ammonium salt increases of phosphorylation of a number of proteins by inhibiting PP, and acts as a tumor promoter. Okadaic acid ammonium salt induces tau phosphorylation .
Methylene blue (hydrate) (Standard) is the analytical standard of Methylene blue (hydrate). This product is intended for research and analytical applications. Methylene blue (Basic Blue 9) hydrate is a guanylyl cyclase (sGC), monoamine oxidase A (MAO-A) and NO synthase (NOS) inhibitor. Methylene blue is a vasopressor and is often used as a dye in several medical procedures. Methylene blue hydrate through the nitric oxide syntase/guanylate cyclase signalling pathway to reduce prepulse inhibition. Methylene blue hydrate is a REDOX cycling compound and able to cross the blood-brain barrier. Methylene blue hydrate is a Tau aggregation inhibitor. Methylene blue hydrate reduces cerebral edema, attenuated microglial activation and reduced neuroinflammation .
Methylene blue (purity≥70%) is a guanylyl cyclase (sGC), monoamine oxidase A (MAO-A) and NO synthase (NOS) inhibitor. Methylene blue (purity≥70%) is a vasopressor and is often used as a dye in several medical procedures. Methylene blue (purity≥70%) through the nitric oxide syntase/guanylate cyclase signalling pathway to reduce prepulse inhibition. Methylene blue (purity≥70%) is a REDOX cycling compound and able to cross the blood-brain barrier. Methylene blue (purity≥70%) is a Tau aggregation inhibitor. Methylene blue reduces cerebral edema, attenuated microglial activation and reduced neuroinflammation .
hAChE-IN-5 (compound 49) is a potent hAChE and hBuChE inhibitor with IC50 values of 0.17 μM and 0.17 μM, respectively. hAChE-IN-5 shows potent GSK3β inhibition with an IC50 value of 0.21 μM. hAChE-IN-5 is used as tau protein aggregation and Aβ1-42 self-aggregation inhibitor. hAChE-IN-5 can bind virtually with the PAS affecting Aβ aggregation, thus preventing Aβ-dependent neurotoxicity. hAChE-IN-5 can penetrate BBB and has the potential for multi-targeted anti-Alzheimer's agents research .
Multitarget AD inhibitor-1 is a selective and reversible butyrylcholinesterase (BuChE) inhibitor with IC50s of 7.22 μM and 1.55 μM for hBuChE and eqBuChE (BuChE from equine serum), respectively. Multitarget AD inhibitor-1 inhibits β-secretase (IC50hBACE-1=41.60 μM), amyloid β aggregation (IC50Aβ=3.09 μM), tau aggregation. Multitarget AD inhibitor-1, a diphenylpropylamine derivative, has the potential for multifunctional disease-modifying anti-Alzheimer’s research .
Rolofylline (Standard) is the analytical standard of Rolofylline. This product is intended for research and analytical applications. Rolofylline (KW-3902) is a potent, selective adenosine A1 receptor antagonist that is under development for the treatment of patients with acute congestive heart failure and renal impairment.
Rolofylline is metabolized primarily to the pharmacologically active M1-trans and M1-cis metabolites by cytochrome P450 (CYP450) .
Rolofylline is alleviating the presynaptic dysfunction and restores neuronal activity as well as dendritic spine levels in vitro, is an interesting candidate to combat the hypometabolism and neuronal dysfunction associated with Tau-induced neurodegenerative diseases .
Levistolide A is an apoptosis inducer and a PEDV virus inhibitor. Levistolide A can induce apoptosis in colon cancer cells and suppress the replication of porcine epidemic diarrhea virus (PEDV) by promoting ROS generation. Levistolide A activates peroxisome proliferator-activated receptor γ (PPARγ) in N2a/APP695swe cells and reduces excessive phosphorylation of tau through the GSK3α/β pathway, improving symptoms in Alzheimer’s mice. Levistolide A improves kidney damage in 5/6 nephrectomy (Nx) mice by inhibiting the RAS,TGF-β1/Smad, and MAPK pathways .
GSK-3β/HDAC-IN-2 is a potent inhibitor of GSK-3β (IC50 = 0.04 μM), HDAC2 (IC50 = 1.05 μM, Ki = 0.070 μM) and HDAC6 (IC50 = 1.52 μM, Ki = 0.017 μM). GSK-3β/HDAC-IN-2 inhibits HDAC2 and HDAC6 activities and blocks tau hyperphosphorylation. GSK-3β/HDAC-IN-2 exerts neuroprotective effects and shows no significant toxicity. GSK-3β/HDAC-IN-2 can be used in the research of Alzheimer's disease.
AChE/BChE-IN-23 (Compound 6e) is an AChE/BChE inhibitor (IC50: 0.91 μM, 1.19 μM and 1.01 μM for hAChE, eq BChE and hBChE, respectively). AChE/BChE-IN-23 has antioxidant activity and inhibits Aβ1-42 and Tau protein aggregation. AChE/BChE-IN-23 also inhibits microglial activation by reducing ROS release and mitochondrial injury. AChE/BChE-IN-23 suppresses NLRP3 inflammasome and pro-inflammatory cytokines in human microglial cells. AChE/BChE-IN-23 also reverses the Scopolamine (HY-N0296)-induced memory impairment in mice model .
Mouse Serum Albumin is most abundant protein in plasma, which leaks into the brain parenchyma when the blood-brain barrier (BBB) is impaired. Mouse Serum Albumin induces astrocytes to A1 phenotype to remarkably increase levels of Elovl1. Mouse Serum Albumin promotes VLSFAs secretion and causes neuronal lippoapoptosis through endoplasmic reticulum stress response pathway. MSA-activated microglia triggeres remarkable tau phosphorylation at multiple sites (Ser202/Thr205) through NLRP3 inflammasome pathway. Mouse Serum Albumin decreases the spatial learning and memory abilities in mice. Mouse Serum Albumin can be used for the study of neurodegenerative diseases like Alzheimer’s disease (AD) and frontotemporal dementia (FTD) .
Myricanol is a diarylheptanoid and a Nampt activator. Myricanol exerts anti-inflammatory effects and alleviates glucocorticoid-induced muscle atrophy by increasing Sirtuin 1 (SIRT1) and PRDX5 activities while regulating inflammatory factors. Myricanol exhibits growth inhibition and induces apoptosis in human lung adenocarcinoma A549 cells. Myricanol promotes autophagy-mediated clearance of microtubule-associated protein tau to exert neuroprotective effects. Myricanol protects cardiovascular function by inhibiting PDGFRβ and NF-κB signaling pathways. Myricanol activates mitochondrial transcription factor A (TFAM) expression to exert anti-renal fibrosis effects. Myricanol improves insulin resistance through AMPK activation .
GSK-3β inhibitor 15 (Compound 54) is a GSK-3β inhibitor (IC50: 3.4 nM). GSK-3β inhibitor 15 inhibits Aβ1-42-induced GSK-3β and tau protein phosphorylation. GSK-3β inhibitor 15 inhibits LPS-induced iNOS expression. GSK-3β inhibitor 15 has neuroprotective effects on Aβ1-42-induced neurotoxicity. GSK-3β inhibitor 15 can be used for research of Alzheimer’s disease (AD) .
H3R antagonist 4 (compound 11L) was a dual inhibitor of cholinesterase and histamine receptor (H3R), with corresponding IC50 of 7.04 μM (eeAChE), 9.73 μM (hAChE)(reversible) and 1.09 nM (H3R) , respectively. H3R antagonist 4 inhibited the aggregation of Aβ1-42 induced by itself and Cu 2+ (95.48% and 88.63%) , and degraded the Aβ1-42 fibrils induced by itself and Cu 2+ (80.16% and 89.30%) . H3R antagonist 4 chelate biometals such as Cu 2+, Zn 2+, Al 3+, and Fe 2+. H3R antagonist 4 significantly reduced tau protein hyperphosphorylation induced by Aβ1-42 and inhibited RSL-3-induced apoptosis and ferroptosis in PC12 cells. H3R antagonist 4 had the best blood-brain barrier permeability and intestinal absorption in hCMEC/D3 and hPepT1-MDCK cells.H3R antagonist 4 ameliorates learning and memory impairment in a mouse model of Alzheimer's disease induced by scopolamine (HY-N0296) .
Alzheimer’s Disease (AD) is a progressive degenerative brain disease which causes mental and physical decline, gradually resulting in death. Despite the significant public health issue that it poses, only few medical treatments have been approved for Alzheimer’s Disease (AD) and these act to control symptoms rather than alter the course of the disease. Discovery of new therapeutic approaches depends on the study of pathology of AD. Recent research findings have led to greater understanding of disease neurobiology in Alzheimer's Disease (AD) and identification of unique targets for drug development. Several important mechanisms have been proposed to explain the underlying pathology of AD, such as Amyloid cascade hypothesis, Tau hypothesis and Cholinergic hypothesis, etc.
MCE offers a unique collection of 1,817 compounds with anti-Alzheimer’s Disease activities or targeting the unique targets of AD. MCE Anti-Alzheimer’s Disease Compound Library is a useful tool for exploring the mechanism of AD and discovering new drugs for AD.
BSB is a Congo red-derived fluorescent probe. BSB binds not only to extracellular amyloid β protein, but also many intracellular lesions composed of abnormal tau and synuclein proteins. BSB acts as a prototype imaging agent for Alzheimer's disease .
Leucomethylene blue (TRx0237) mesylate, an orally active second-generation tau protein aggregation inhibitor (Ki of 0.12 μM), could be used for the study of Alzheimer's Disease. Leucomethylene blue mesylate is a common reduced form of Methylene Blue, Methylene Blue is a member of the thiazine class of dyes .
Methylene blue (Basic Blue 9) is a guanylyl cyclase (sGC), monoamine oxidase A (MAO-A) and NO synthase (NOS) inhibitor. Methylene blue is a vasopressor and is often used as a dye in several medical procedures. Methylene blue through the nitric oxide syntase/guanylate cyclase signalling pathway to reduce prepulse inhibition. Methylene blue is a REDOX cycling compound and able to cross the blood-brain barrier. Methylene blue is a Tau aggregation inhibitor. Methylene Blue is a photosensitizer and redox agent. Methylene blue reduces cerebral edema, attenuated microglial activation and reduced neuroinflammation .
Methylene blue (purity≥70%) is a guanylyl cyclase (sGC), monoamine oxidase A (MAO-A) and NO synthase (NOS) inhibitor. Methylene blue (purity≥70%) is a vasopressor and is often used as a dye in several medical procedures. Methylene blue (purity≥70%) through the nitric oxide syntase/guanylate cyclase signalling pathway to reduce prepulse inhibition. Methylene blue (purity≥70%) is a REDOX cycling compound and able to cross the blood-brain barrier. Methylene blue (purity≥70%) is a Tau aggregation inhibitor. Methylene blue reduces cerebral edema, attenuated microglial activation and reduced neuroinflammation .
Methylene Blue (Standard) is the analytical standard of Methylene Blue. This product is intended for research and analytical applications. Methylene blue (Basic Blue 9) is a guanylyl cyclase (sGC), monoamine oxidase A (MAO-A) and NO synthase (NOS) inhibitor. Methylene blue is a vasopressor and is often used as a dye in several medical procedures. Methylene blue through the nitric oxide syntase/guanylate cyclase signalling pathway to reduce prepulse inhibition. Methylene blue is a REDOX cycling compound and able to cross the blood-brain barrier. Methylene blue is a Tau aggregation inhibitor. Methylene blue reduces cerebral edema, attenuated microglial activation and reduced neuroinflammation .
Mouse Serum Albumin is most abundant protein in plasma, which leaks into the brain parenchyma when the blood-brain barrier (BBB) is impaired. Mouse Serum Albumin induces astrocytes to A1 phenotype to remarkably increase levels of Elovl1. Mouse Serum Albumin promotes VLSFAs secretion and causes neuronal lippoapoptosis through endoplasmic reticulum stress response pathway. MSA-activated microglia triggeres remarkable tau phosphorylation at multiple sites (Ser202/Thr205) through NLRP3 inflammasome pathway. Mouse Serum Albumin decreases the spatial learning and memory abilities in mice. Mouse Serum Albumin can be used for the study of neurodegenerative diseases like Alzheimer’s disease (AD) and frontotemporal dementia (FTD) .
Tau protein (592-597), human TFA is a peptide fragment of human Tau protein. The dysfunction of Tau protein is involved in neurodegeneration and dementia .
Tau Peptide (275-305) (Repeat 2 domain) is the Alzheimer's Tau fragment R2, corresponding to the second repeat unit of the microtubule-binding domain, which is believed to be pivotal to the biochemical properties of full tau protein. Tau Peptide (275-305) specifically coordinates with group IIB metal ions (Zn²⁺, Cd²⁺, Hg²⁺), which can induce their conformational changes and significantly promote their pathological accumulation. Tau Peptide (275-305) can be used to study the role of heavy metals in neurodegenerative diseases .
Microtubule-associated protein tau (26-44) is a synthetic peptide chain with an amine group attached to glutamine and an carboxyl group attached to lysine.
Acetyl-Tau Peptide (273-284) amide is an acetylated Tau peptide fragment. Acetyl-Tau Peptide (273-284) amide limits the substantial aggregation of Ac-Aβ(25–35)-NH2 and can be used as an inhibitor of Ac-Aβ(25–35)-NH2. Acetyl-Tau Peptide (273-284) amide can be used as an experimental model to investigate the Aβ/Tau cross-interaction .
Tau Peptide (301-315) is a polypeptide that can be found by peptide screening. Peptide screening is a research tool that pools active peptides primarily by immunoassay. Peptide screening can be used for protein interaction, functional analysis, epitope screening, especially in the field of agent research and development .
Tau Peptide (298-312) is a polypeptide that can be found by peptide screening. Peptide screening is a research tool that pools active peptides primarily by immunoassay. Peptide screening can be used for protein interaction, functional analysis, epitope screening, especially in the field of agent research and development .
Tau Peptide (306-317) is a polypeptide that can be found by peptide screening. Peptide screening is a research tool that pools active peptides primarily by immunoassay. Peptide screening can be used for protein interaction, functional analysis, epitope screening, especially in the field of agent research and development .
Tau Peptide (304-318) is a polypeptide that can be found by peptide screening. Peptide screening is a research tool that pools active peptides primarily by immunoassay. Peptide screening can be used for protein interaction, functional analysis, epitope screening, especially in the field of agent research and development .
Tau Peptide (307-321) is a polypeptide that can be found by peptide screening. Peptide screening is a research tool that pools active peptides primarily by immunoassay. Peptide screening can be used for protein interaction, functional analysis, epitope screening, especially in the field of agent research and development .
Tau Peptide (274-288) is a polypeptide that can be found by peptide screening. Peptide screening is a research tool that pools active peptides primarily by immunoassay. Peptide screening can be used for protein interaction, functional analysis, epitope screening, especially in the field of agent research and development .
Tau Peptide (295-309) is a polypeptide that can be found by peptide screening. Peptide screening is a research tool that pools active peptides primarily by immunoassay. Peptide screening can be used for protein interaction, functional analysis, epitope screening, especially in the field of agent research and development .
Tau Peptide (268-282) is a polypeptide that can be found by peptide screening. Peptide screening is a research tool that pools active peptides primarily by immunoassay. Peptide screening can be used for protein interaction, functional analysis, epitope screening, especially in the field of agent research and development .
Tau Peptide (277-291) is a polypeptide that can be found by peptide screening. Peptide screening is a research tool that pools active peptides primarily by immunoassay. Peptide screening can be used for protein interaction, functional analysis, epitope screening, especially in the field of agent research and development .
Tau Peptide (512-525) amide is a polypeptide that can be found by peptide screening. Peptide screening is a research tool that pools active peptides primarily by immunoassay. Peptide screening can be used for protein interaction, functional analysis, epitope screening, especially in the field of agent research and development .
(Ser(PO3H2)396,404)-Tau Peptide (379-408) is a polypeptide that can be found by peptide screening. Peptide screening is a research tool that pools active peptides primarily by immunoassay. Peptide screening can be used for protein interaction, functional analysis, epitope screening, especially in the field of agent research and development .
Tau Peptide (337-368) (Repeat 4 Domain) is a polypeptide that can be found by peptide screening. Peptide screening is a research tool that pools active peptides primarily by immunoassay. Peptide screening can be used for protein interaction, functional analysis, epitope screening, especially in the field of agent research and development .
(Ser(PO3H2)202,Thr(PO3H2)205)-Tau Peptide (194-213) is a polypeptide that can be found by peptide screening. Peptide screening is a research tool that pools active peptides primarily by immunoassay. Peptide screening can be used for protein interaction, functional analysis, epitope screening, especially in the field of agent research and development .
Acetyl-Tau Peptide (244-274) (Repeat 1 Domain) is a polypeptide that can be found by peptide screening. Peptide screening is a research tool that pools active peptides primarily by immunoassay. Peptide screening can be used for protein interaction, functional analysis, epitope screening, especially in the field of agent research and development .
Tau Peptide (255-314) (Repeat 2 Domain) (human) is a polypeptide that can be found by peptide screening. Peptide screening is a research tool that pools active peptides primarily by immunoassay. Peptide screening can be used for protein interaction, functional analysis, epitope screening, especially in the field of agent research and development .
PHF6 (VQIVYK) is a self-assembly sequence capable of initiating the full-length tau protein aggregation and is mapped to the third microtubule-binding repeat region of the tau protein .
PHF6 (VQIVYK) TFA is a self-assembly sequence capable of initiating the full-length tau protein aggregation. PHF6 TFA is mapped to the third microtubule-binding repeat region of the tau protein .
AADvac 1 is an active tau peptide vaccine for Alzheimer's disease research. AADvac 1 is composed of a regulatory peptide 294KDNIKHVPGGGS 305 that drives tau oligomerization conjugated to Aplysia hemocyanin (KLH) and formulated with aluminum hydroxide .
CHIPOpt, a peptide, is an orthosteric CHIP TPR domain inhibitor with a Kd of ∼16 nM. CHIPOpt has anti-aggregation activity and decreases p.tau ubiquitination with little effect on unmodified tau. CHIPOpt can be used for Alzheimer’s disease research .
AADvac 1 TFA is an active tau peptide vaccine for Alzheimer's disease research. AADvac 1 TFA is composed of a regulatory peptide 294KDNIKHVPGGGS 305 that drives tau oligomerization conjugated to Aplysia hemocyanin (KLH) and formulated with aluminum hydroxide .
Ac-Val-Gln-aIle-Val-aTyr-Lys-NH2 is a N-amino peptide that selectivity inhibits the fibrilization of tau protein. Ac-Val-Gln-aIle-Val-aTyr-Lys-NH2 is effective at blocking the cellular seeding of endogenous tau by interacting with monomeric or fibrillar forms of extracellular tau. Ac-Val-Gln-aIle-Val-aTyr-Lys-NH2 can be used for the study of neurodegenerative diseases, such as Alzheimer’s disease .
RI-AG03 is an orally active and a BBB-penetrable Tau aggregation peptide inhibitor. RI-AG03 inhibits Tau aggregation and improves associated neurodegeneration and behavioral phenotypes in both in vivo and in vitro models. RI-AG03 can be used in the study of tauopathies such as Alzheimer's disease .
RI-AG03 acetate is the acetate of RI-AG03 (HY-P10861). RI-AG03 is an orally active and a BBB-penetrable Tau aggregation peptide inhibitor. RI-AG03 inhibits Tau aggregation and improves associated neurodegeneration and behavioral phenotypes in both in vivo and in vitro models. RI-AG03 can be used in the study of tauopathies such as Alzheimer's disease .
N-Boc-trans-4-fluoro-L-proline is a non-natural amino acid substitute used to construct monoclonal antibodies that specifically target the seed conformation of tau protein .
Posdinemab (JNJ-63733657) is a humanized IgG1/κ monoclonal antibody that selectively targets phosphorylated tau (pT217). Posdinemab specifically binds to the pT217+tau epitope rich in the proline domain, blocks tau protein aggregation and seed propagation, and promotes the clearance of extracellular tau species. Posdinemab reduces the levels of free and total p217+tau in cerebrospinal fluid, thereby inhibiting the pathological propagation of tau protein and the formation of neurofibrillary tangles. Posdinemab can be used for the study of progressive supranuclear palsy syndrome and Alzheimer's disease (AD), especially for prodromal or mild AD disease .
APNmAb005 is a human monoclonal antibody (mAb) targeting MAPT/Tau/PHF-tau. APNmAb005 blocks tau seeding in vitro and rescues neuronal loss in rTG4510 mice. APNmAb005 can be used in Alzheimer’s disease (AD) research .
Semorinemab (RG 6100) is an anti-Tau humanized IgG4 monoclonal antibody, targets the N-terminal portion of the Tau protein (amino acid residues 6-23). Semorinemab binds with human Tau with a Kd value of 3.8 nM. Semorinemab can be used for the research of Alzheimer's Disease .
Zagotenemab (LY3303560) is a humanised anti-tau antibody that selectively binds and neutralises tau deposits in the brain. Zagotenemab can be used in Alzheimer's disease research .
Gosuranemab (BMS-986168; IPN007) is a humanised IgG4 anti-tau monoclonal antibody. Gosuranemab neutralizes the extracellular tau protein, inhibiting the spread and aggregation of pathological tau protein. Gosuranemab can be used for the researches of alzheimer’s disease (AD) and progressive supranuclear palsy (PSP) .
Tilavonemab (ABBV-8E12) is a humanized anti-tau monoclonal antibody that binds to amino acids 25-30 near the N-terminus of the tau protein. Tilavonemab can block the ability of human and mouse neurons to uptake tau aggregates. Tilavonemab can be used for research on Alzheimer’s disease and other tauopathies .
Bepranemab (UCB 0107) is a humanized, full-length IgG4 monoclonal antibody. Bepranemab targets the central portion of tau, specifically amino acids 235 to 246. Bepranemab can be used for Alzheimer’s disease (AD) research .
TBL-100 is a human monoclonal antibody (mAb) targeting Tau. TBL-100 can be used in Alzheimer's disease (AD) and Progressive supranuclear palsy research .
PNT001 is a human IgG1 monoclonal antibody (mAb) targeting cis-pT231 Tau. PNT001 can be used in Neurodegenerative disorders and Traumatic brain injuries research. Recommended isotype control: Human IgG1 kappa, Isotype Control (HY-P99001) .
Anti-Mouse/Human PrP/prion protein Antibody (TW1) is a mouse-derived IgG2a type antibody inhibitor, targeting to mouse/human PrP/prion protein. Anti-Mouse/Human PrP/prion protein Antibody (TW1) binds to both PrPc (cellular prion protein) and PrPSc (Scrapie Prion Protein) and blocks the interaction of prion protein with tau protein. Anti-Mouse/Human PrP/prion protein Antibody (TW1) can be used for the researches of Alzheimer’s disease (AD) .
Saikosaponin C is a bioactive component found in radix bupleuri, targets amyloid beta and tau in Alzheimer's disease. Saikosaponin C inhibits the secretion of both Aβ1-40 and Aβ1-42, and suppresses abnormal tau phosphorylation, but shows no effect on BACE1 activity and expression .
Quercetagitrin (Quercetagetin-7-O-glucoside) is a natural product that can be isolated from the African marigold (Tagetes erecta). Quercetagitrin has anti-inflammatory activity. Quercetagitrin inhibits Tau accumulation. Quercetagitrin can reverse neuroinflammation and cognitive deficits in P301S-Tau transgenic mouse model through inhibiting NF-κB activation. Quercetagitrin is a dual-target inhibitor of PTPN6 (IC50 = 1 μM) and PTPN9 (IC50 = 1.7 μM). Quercetagitrin enhances glucose uptake by mature C2C12 myoblasts. Quercetagitrin can be studied in research for Alzheimer’s disease and type 2 diabetes .
4-Hydroxyisophthalic acid activates antioxidant enzymes (such as catalase CAT and superoxide dismutase SOD), scavenges free radicals, and exhibits antioxidant property. 4-Hydroxyisophthalic acid activates AChE and BChE, enhances neuronal function and improves Tau-induced neurobehavioral defects. 4-Hydroxyisophthalic acid improves the cognitive defects, and ameliorates circadian rhythm disorders of fruit flies .
Nimbin is an orally active intermediate limonoid found in Azadirachta. Nimbin prevents tau aggregation and increases cell viability. Nimbin is effective inhibits the envelope protein of dengue virus. Nimbin has anti-inflammatory, antipyretic, antifungal, antihistamine, antiseptic, antioxidant, anti-cancer and anti-viral properties. Nimbin can across blood-brain barrier. Nimbin is promising for research of neurodegenerative diseases and viral infections .
(-)Clausenamide is an active alkaloid isolated from the leaves of Clausena lansium (Lour.) Skeels, and improves cognitive function in both normal physiological and pathological conditions. (-)Clausenamide inhibits β-amyloid (Aβ) toxicity, blocking neurofibrillary tangle formation by inhibiting the phosphorylation of tau protein. (-)Clausenamide exerts a significant neuroprotective activity against Aβ25-35. (-)Clausenamide can be used for researching Alzheimer's disease (AD) .
Annonacin is an acetylgenin that is toxic by inhibiting the pathway of the mitochondrial complex. Annonacin increases tau phosphorylation in R406W +/+ mice. Annonacin acts as an inhibitor of the sodium/potassium and sarcoplasmic reticulum (SERCA) ATPase pumps. Annonacin has significant killing effect on ovarian cancer cell, cervical cancer cell, breast cancer cell, bladder cancer cell and skin cancer cell. Annonacin induces apoptosis through Bax and Caspase-3-related pathways .
Okadaic acid, a marine toxin, is an inhibitor of protein phosphatases (PP). Okadaic acid has a significantly higher affinity for PP2A (IC50=0.1-0.3 nM), and inhibits PP1 (IC50=15-50 nM), PP3 (IC50=3.7-4 nM), PP4 (IC50=0.1 nM), PP5 (IC50=3.5 nM), but does not inhibit PP2C. Okadaic acid increases of phosphorylation of a number of proteins by inhibiting PP, and acts a tumor promoter. Okadaic acid induces tau phosphorylation .
Punicic acid is a bioactive compound of pomegranate seed oil. Punicic acid is an isomer of conjugated α-linolenic acid and ω-5 polyunsaturated fatty acids. Punicic acid has anti-inflammatory and antioxidant activities and can inhibit the expression of inflammatory mediators such as tumor necrosis factor α (TNF-α). Punicic acid can also reduce the formation of β-amyloid deposits and hyperphosphorylation of tau by increasing the expression of GLUT4 protein and inhibiting the overactivation of calpain, and is used to prevent and treat neurodegenerative diseases. In addition, punicic acid also has breast cancer inhibitor properties that depend on lipid peroxidation and PKC pathways .
Saikosaponin C (Standard) is the analytical standard of Saikosaponin C. This product is intended for research and analytical applications. Saikosaponin C is a bioactive component found in radix bupleuri, targets amyloid beta and tau in Alzheimer's disease. Saikosaponin C inhibits the secretion of both Aβ1-40 and Aβ1-42, and suppresses abnormal tau phosphorylation, but shows no effect on BACE1 activity and expression .
Quercetagitrin (Standard) is the analytical standard of Quercetagitrin. This product is intended for research and analytical applications. Quercetagitrin (Quercetagetin-7-O-glucoside) is a natural product that can be isolated from the African marigold (Tagetes erecta). Quercetagitrin has anti-inflammatory activity. Quercetagitrin inhibits Tau accumulation. Quercetagitrin can reverse neuroinflammation and cognitive deficits in P301S-Tau transgenic mouse model through inhibiting NF-κB activation. Quercetagitrin is a dual-target inhibitor of PTPN6 (IC50 = 1 μM) and PTPN9 (IC50 = 1.7 μM). Quercetagitrin enhances glucose uptake by mature C2C12 myoblasts. Quercetagitrin can be studied in research for Alzheimer’s disease and type 2 diabetes .
Levistolide A is an apoptosis inducer and a PEDV virus inhibitor. Levistolide A can induce apoptosis in colon cancer cells and suppress the replication of porcine epidemic diarrhea virus (PEDV) by promoting ROS generation. Levistolide A activates peroxisome proliferator-activated receptor γ (PPARγ) in N2a/APP695swe cells and reduces excessive phosphorylation of tau through the GSK3α/β pathway, improving symptoms in Alzheimer’s mice. Levistolide A improves kidney damage in 5/6 nephrectomy (Nx) mice by inhibiting the RAS,TGF-β1/Smad, and MAPK pathways .
Myricanol is a diarylheptanoid and a Nampt activator. Myricanol exerts anti-inflammatory effects and alleviates glucocorticoid-induced muscle atrophy by increasing Sirtuin 1 (SIRT1) and PRDX5 activities while regulating inflammatory factors. Myricanol exhibits growth inhibition and induces apoptosis in human lung adenocarcinoma A549 cells. Myricanol promotes autophagy-mediated clearance of microtubule-associated protein tau to exert neuroprotective effects. Myricanol protects cardiovascular function by inhibiting PDGFRβ and NF-κB signaling pathways. Myricanol activates mitochondrial transcription factor A (TFAM) expression to exert anti-renal fibrosis effects. Myricanol improves insulin resistance through AMPK activation .
Tau/0N3R protein is encoded by the Tau/0N3R gene and undergoes regulated alternative splicing to produce different mRNA species.Its expression varies in the nervous system according to the maturation and type of neurons.Fetal-tau/0N3R Protein, Human (His) is the recombinant human-derived Fetal-tau/0N3R protein, expressed by E.coli , with N-6*His labeled tag.
Microtubule-associated protein tau (MAPT) plays a key role in promoting microtubule assembly and stability, suggesting its potential contribution to the establishment of neuronal polarity.The C terminus binds to axonal microtubules, whereas the N terminus interacts with neuroplasmic membrane components, serving as a key linker protein between these structures.PNS-Tau/MAPT Protein, Mouse (P.pastoris, His) is the recombinant mouse-derived Microtubule-associated protein tau protein, expressed by P.pastoris , with N-6*His labeled tag.
Tau/0N3R protein is encoded by the Tau/0N3R gene and undergoes regulated alternative splicing to produce different mRNA species. Its expression varies in the nervous system according to the maturation and type of neurons. Tau/0N3R Protein, Human (His, solution) is the recombinant human-derived Tau/0N3R protein, expressed by E. coli , with N-His labeled tag.
Microtubule-associated protein tau is a microtubule-associated protein found in large numbers in neurons of the central nervous system (CNS). MAPT promotes microtubule assembly and stability and may be involved in the establishment and maintenance of neuronal polarity. Overexpression of MAPT is associated with a poor prognosis of prostate cancer. MAPT has been linked to neurological disorders such as Alzheimer's and Parkinson's disease. Tau-D/0N4R Protein, Human (133a.a, His) is the recombinant human-derived Tau-D/0N4R protein, expressed by E. coli , with C-6*His labeled tag.
Microtubule-associated protein tau is a microtubule-associated protein found in large numbers in neurons of the central nervous system (CNS). MAPT promotes microtubule assembly and stability and may be involved in the establishment and maintenance of neuronal polarity. Overexpression of MAPT is associated with a poor prognosis of prostate cancer. MAPT has been linked to neurological disorders such as Alzheimer's and Parkinson's disease. Tau-F/2N4R Protein, Human (HEK293, His) is the recombinant human-derived Tau-F/2N4R protein, expressed by HEK293 , with N-10*His labeled tag.
Microtubule-associated protein tau (MAPT) critically promotes microtubule assembly and stability, influencing neuronal polarity by acting as an important junction protein. Its dual role involves C-terminal binding to axonal microtubules and N-terminal binding to neuroplasmic membrane components. Tau-A/SC1 Protein, Rat (P.pastoris, His) is the recombinant rat-derived Microtubule-associated protein tau protein, expressed by P. pastoris , with N-His labeled tag.
Microtubule-associated protein tau is a microtubule-associated protein found in large numbers in neurons of the central nervous system (CNS). MAPT promotes microtubule assembly and stability and may be involved in the establishment and maintenance of neuronal polarity. Overexpression of MAPT is associated with a poor prognosis of prostate cancer. MAPT has been linked to neurological disorders such as Alzheimer's and Parkinson's disease. Tau-441/2N4R Pre-formed Fibrils Protein, Human is the recombinant human-derived Tau-441/2N4R Pre-formed Fibrils protein, expressed by E. coli, with tag free.
Microtubule-associated protein tau (MAPT) plays a key role in promoting microtubule assembly and stability, suggesting its potential contribution to the establishment of neuronal polarity.The C terminus binds to axonal microtubules, whereas the N terminus interacts with neuroplasmic membrane components, serving as a key linker protein between these structures.PNS-Tau/MAPT Protein, Mouse (HEK293, His) is the recombinant mouse-derived PNS-Tau/MAPT protein, expressed by HEK293 , with N-10*His labeled tag.
Tau/MAPT proteins crucially promote microtubule assembly and stability, which are critical for neuronal polarity. Structurally, its C terminus binds to axonal microtubules and its N terminus binds to neuroplasmic membrane components, suggesting its role as a connexin connecting microtubules to the plasma membrane. Tau-A/MAPT Protein, Macaca mulatta (HEK293, His) is the recombinant Rhesus Macaque-derived Tau-A/MAPT protein, expressed by HEK293 , with N-10*His labeled tag.
Microtubule-associated protein tau (MAPT) critically promotes microtubule assembly and stability, influencing neuronal polarity by acting as an important junction protein. Its dual role involves C-terminal binding to axonal microtubules and N-terminal binding to neuroplasmic membrane components. Tau-A/SC1 Protein, Rat (HEK293, His) is the recombinant rat-derived Tau-A/SC1 protein, expressed by HEK293 , with N-10*His labeled tag.
Microtubule-associated protein tau is a microtubule-associated protein found in large numbers in neurons of the central nervous system (CNS). MAPT promotes microtubule assembly and stability and may be involved in the establishment and maintenance of neuronal polarity. Overexpression of MAPT is associated with a poor prognosis of prostate cancer. MAPT has been linked to neurological disorders such as Alzheimer's and Parkinson's disease. Tau-F/2N4R Protein, Human is the recombinant human-derived Tau-F/2N4R protein, expressed by E. coli , with tag free.
Interferon tau-1 (IFNT1) serves as an important paracrine hormone that initiates maternal recognition of pregnancy. After interacting with endometrial receptors, possibly type I interferon receptors, IFNT1 blocks estrogen receptor expression and prevents estrogen-induced upregulation of oxytocin receptor expression. Interferon tau-1/IFNT1 Protein, Bovine (P.pastoris, His) is the recombinant bovine-derived Interferon tau-1/IFNT1 protein, expressed by P. pastoris , with N-His labeled tag.
14-3-3 theta proteins are adapters in multiple signaling pathways that recognize phosphoserine or phosphothreonine motifs and modulate chaperone activity upon binding. It negatively regulates PDPK1 kinase activity, forms homodimers, and interacts with CDK16, phosphorylated RGS7, SSH1, phosphorylated CDKN1B, GAB2, phosphorylated PDPK1, and phosphorylated DAPK2. 14-3-3 theta Protein, Human (GST) is the recombinant human-derived 14-3-3 theta protein, expressed by E. coli , with N-GST labeled tag.
The CK1d protein is an important serine/threonine protein kinase that complexly controls cellular processes such as Wnt signaling, DNA repair, and circadian rhythms. Its versatility is evident in phosphorylating a variety of proteins, including connexin-43/GJA1, MAP1A, p53/TP53, and YAP1. CK1d Protein, Human (sf9, GST) is the recombinant human-derived CK1d protein, expressed by sf9 insect cells , with N-GST labeled tag.
CDK5 is a proline-directed serine/threonine protein kinase that critically regulates neuronal cell cycle, differentiation and potential apoptosis in neuronal diseases by preventing cell cycle re-entry. It interacts with numerous proteins involved in neuronal development and coordinates processes such as survival, migration, differentiation, axonal growth, synaptogenesis, and neurotransmission. CDK5-p25 Protein, Human (sf9, GST, His, Flag) is the recombinant human-derived CDK5-p25, expressed by Sf9 insect cells, with N-GST, N-His, N-Flag labeled tag.
CDK5 is a proline-directed serine/threonine protein kinase that critically regulates neuronal cell cycle, differentiation and potential apoptosis in neuronal diseases by preventing cell cycle re-entry. It interacts with numerous proteins involved in neuronal development and coordinates processes such as survival, migration, differentiation, axonal growth, synaptogenesis, and neurotransmission. CDK5-p35 Protein, Human (sf9, GST, His, Flag) is the recombinant human-derived CDK5-p35, expressed by Sf9 insect cells, with N-His, N-GST, N-Flag labeled tag.
Phospho-Tau (Ser202/Thr205) Antibody (YA3436) is a Rabbit-derived and non-conjugated IgG monoclonal antibody, targeting to Phospho-Tau (Ser202/Thr205).
Cyclin-dependent kinase 5; Cell division protein kinase 5; Serine/threonine-protein kinase PSSALRE; tau protein kinase II catalytic subunit; TPKII catalytic subunit;
IHC-P, WB
Human, Mouse, Rat
CDK5 Antibody (YA5385) is a Mouse-derived and non-conjugated monoclonal antibody, targeting to CDK5.
Omigapil maleate, an orally bioavailable GAPDH nitrosylation inhibitor, abrogates Aβ1-42-induced tau acetylation, memory impairment, and locomotor dysfunction in mice. Omigapil maleate has the potential for the research of Alzheimer's disease . Omigapil maleate (CGP3446B maleate) is a apoptosis inhibitor. Omigapil maleate can be used for the research of congenital muscular dystrophy (CMD) . Omigapil (maleate) is a click chemistry reagent, it contains an Alkyne group and can undergo copper-catalyzed azide-alkyne cycloaddition (CuAAc) with molecules containing Azide groups.
TauASO-12 (murine) (sodium) is a Tau-lowering antisense oligonucleotide (ASO) for murine use, and it has the potential for the research of Alzheimer Disease. (TauASO-12 sequence – 5′ GCTTTTACTGACCATGCGAG 3′ )
IONIS-MAPTRx sodium is the first Tau-lowering antisense oligonucleotide (ASO). IONIS-MAPTRx sodium has the potential for the research of Alzheimer Disease .
IONIS-MAPTRx (BIIB080) is the first Tau-lowering antisense oligonucleotide (ASO). IONIS-MAPTRx has the potential for the research of Alzheimer Disease .
Inquiry Online
Your information is safe with us. * Required Fields.
